Incidental Mutation 'R1579:Scnn1a'
ID171282
Institutional Source Beutler Lab
Gene Symbol Scnn1a
Ensembl Gene ENSMUSG00000030340
Gene Namesodium channel, nonvoltage-gated 1 alpha
SynonymsENaC alpha, mENaC, Scnn1
MMRRC Submission 039616-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1579 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location125320659-125344943 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125322140 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 61 (F61S)
Ref Sequence ENSEMBL: ENSMUSP00000134929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081440] [ENSMUST00000175966] [ENSMUST00000176110] [ENSMUST00000176365] [ENSMUST00000176442] [ENSMUST00000176655] [ENSMUST00000177329]
Predicted Effect probably damaging
Transcript: ENSMUST00000081440
AA Change: F87S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080164
Gene: ENSMUSG00000030340
AA Change: F87S

DomainStartEndE-ValueType
low complexity region 13 18 N/A INTRINSIC
Pfam:ASC 88 600 1.1e-93 PFAM
low complexity region 647 677 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175966
AA Change: F61S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135551
Gene: ENSMUSG00000030340
AA Change: F61S

DomainStartEndE-ValueType
Pfam:ASC 62 264 3.5e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176110
AA Change: F61S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134940
Gene: ENSMUSG00000030340
AA Change: F61S

DomainStartEndE-ValueType
Pfam:ASC 62 575 1.9e-112 PFAM
low complexity region 621 651 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176365
AA Change: F45S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135467
Gene: ENSMUSG00000030340
AA Change: F45S

DomainStartEndE-ValueType
Pfam:ASC 46 141 1.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176442
SMART Domains Protein: ENSMUSP00000135336
Gene: ENSMUSG00000030340

DomainStartEndE-ValueType
Pfam:ASC 1 494 6.3e-105 PFAM
low complexity region 540 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176655
SMART Domains Protein: ENSMUSP00000135798
Gene: ENSMUSG00000030340

DomainStartEndE-ValueType
Pfam:ASC 1 494 6.4e-105 PFAM
low complexity region 540 570 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177329
AA Change: F61S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134929
Gene: ENSMUSG00000030340
AA Change: F61S

DomainStartEndE-ValueType
Pfam:ASC 62 575 1.9e-112 PFAM
low complexity region 621 651 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nonvoltage-gated, amiloride-sensitive, sodium channels control fluid and electrolyte transport across epithelia in many organs. These channels are heteromeric complexes consisting of 3 subunits: alpha, beta, and gamma. This gene encodes the alpha subunit, and mutations in this gene have been associated with pseudohypoaldosteronism type 1 (PHA1), a rare salt wasting disease resulting from target organ unresponsiveness to mineralocorticoids. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skin with epithelial hyperplasia, abnormal nuclei, premature lipid secretion, and abnormal keratohyaline granules. Mutants die within 40 hours of birth due to inability to clear their lungs of liquid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T C 16: 3,906,175 R162G probably benign Het
Adamtsl4 T A 3: 95,685,497 probably benign Het
Adgrv1 A T 13: 81,563,779 L306H probably damaging Het
Aknad1 T A 3: 108,752,136 Y155* probably null Het
Aldh6a1 C T 12: 84,441,848 R88H possibly damaging Het
Apc2 G C 10: 80,311,345 K715N probably damaging Het
Arhgap45 G A 10: 80,028,977 V798M probably damaging Het
BC037034 T C 5: 138,261,866 I338V probably benign Het
Calcrl T C 2: 84,333,537 T437A probably benign Het
Cdan1 A G 2: 120,730,739 F183L probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntnap4 A G 8: 112,881,830 E1294G possibly damaging Het
Crybg3 C A 16: 59,530,198 G2607V probably damaging Het
Dhx29 G T 13: 112,935,598 probably null Het
Dmrtb1 T A 4: 107,684,125 H13L probably damaging Het
Echdc2 A G 4: 108,173,809 M162V probably benign Het
Entpd8 A G 2: 25,084,974 D439G possibly damaging Het
Fastkd2 C G 1: 63,745,887 H477Q probably null Het
Fbrs A G 7: 127,485,357 E517G probably damaging Het
Gchfr A G 2: 119,172,021 T71A possibly damaging Het
Hecw1 A T 13: 14,377,907 C35S probably damaging Het
Izumo1r C T 9: 14,901,802 R58H probably benign Het
Kif13a T C 13: 46,752,856 E537G possibly damaging Het
Kif13b G A 14: 64,782,341 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lnpk A T 2: 74,547,996 D140E probably damaging Het
Ltbp1 A G 17: 75,252,367 M284V probably benign Het
Me3 A T 7: 89,845,842 T323S possibly damaging Het
Mtus1 A G 8: 41,082,858 V607A probably damaging Het
Myh14 A T 7: 44,655,694 probably null Het
Myo1h T A 5: 114,347,435 C545* probably null Het
Nbn T A 4: 15,964,289 D121E probably damaging Het
Nox4 A G 7: 87,370,023 Y408C probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1153 G A 2: 87,896,942 A248T probably benign Het
Olfr1491 A G 19: 13,705,202 D125G probably damaging Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Osbpl5 T C 7: 143,709,202 T150A possibly damaging Het
Pgap3 C A 11: 98,390,053 M265I probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd2l2 A T 18: 34,427,393 N351I possibly damaging Het
Prkdc T A 16: 15,675,328 Y700N probably benign Het
Pzp A G 6: 128,523,968 probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptor A T 11: 119,896,001 Q1264L probably benign Het
Tenm2 C A 11: 36,106,783 W825C probably damaging Het
Tex264 A T 9: 106,681,917 I70N possibly damaging Het
Tns2 G T 15: 102,111,210 D504Y probably damaging Het
Trpc2 T A 7: 102,084,240 F132Y probably damaging Het
Trpm4 A G 7: 45,308,597 F816S probably damaging Het
Uqcc1 G A 2: 155,921,721 Q5* probably null Het
Usp36 G T 11: 118,284,945 T130N probably damaging Het
Vav1 A G 17: 57,297,252 M165V probably benign Het
Vmn1r64 A T 7: 5,883,804 F247I probably damaging Het
Vmn2r26 G C 6: 124,039,747 R390P probably benign Het
Vmn2r57 G T 7: 41,400,124 H734N probably benign Het
Wfdc16 G T 2: 164,635,923 H69N possibly damaging Het
Zfp316 C T 5: 143,253,562 E901K probably damaging Het
Zfp334 T C 2: 165,381,799 E108G probably damaging Het
Zfp407 T C 18: 84,209,638 S1949G probably benign Het
Zfp408 A G 2: 91,646,128 L227P probably benign Het
Zfp560 T C 9: 20,347,991 H525R possibly damaging Het
Zfp609 G A 9: 65,704,472 A403V possibly damaging Het
Other mutations in Scnn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Scnn1a APN 6 125338379 missense probably benign 0.11
IGL01793:Scnn1a APN 6 125343703 missense probably benign 0.03
IGL01992:Scnn1a APN 6 125338937 critical splice donor site probably null
IGL03280:Scnn1a APN 6 125342781 splice site probably benign
R0086:Scnn1a UTSW 6 125342587 splice site probably benign
R0442:Scnn1a UTSW 6 125339137 missense probably damaging 1.00
R0454:Scnn1a UTSW 6 125322226 missense probably damaging 1.00
R0578:Scnn1a UTSW 6 125322244 missense probably damaging 0.97
R1538:Scnn1a UTSW 6 125338893 missense possibly damaging 0.48
R1803:Scnn1a UTSW 6 125332194 missense probably damaging 0.98
R1876:Scnn1a UTSW 6 125338838 missense probably benign 0.05
R2113:Scnn1a UTSW 6 125337811 missense possibly damaging 0.60
R2178:Scnn1a UTSW 6 125331002 missense probably damaging 0.96
R2960:Scnn1a UTSW 6 125322293 missense probably damaging 1.00
R4072:Scnn1a UTSW 6 125338907 missense probably damaging 1.00
R4603:Scnn1a UTSW 6 125322160 missense probably damaging 1.00
R4928:Scnn1a UTSW 6 125322173 missense probably damaging 1.00
R5436:Scnn1a UTSW 6 125343022 missense possibly damaging 0.94
R6812:Scnn1a UTSW 6 125337856 missense probably benign 0.09
X0026:Scnn1a UTSW 6 125322110 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAACAATTTCAAGGAGCAAGACC -3'
(R):5'- TCTCTCTGCGACTGACCTGTAAGG -3'

Sequencing Primer
(F):5'- AGGAGCAAGACCTTTGTCCTC -3'
(R):5'- AGACCAGCTTGTCCGAATTG -3'
Posted On2014-04-13