Incidental Mutation 'R1579:Pzp'
ID171283
Institutional Source Beutler Lab
Gene Symbol Pzp
Ensembl Gene ENSMUSG00000030359
Gene NamePZP, alpha-2-macroglobulin like
Synonyms
MMRRC Submission 039616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R1579 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location128483567-128526720 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 128523968 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112132] [ENSMUST00000143664]
Predicted Effect probably null
Transcript: ENSMUST00000032510
SMART Domains Protein: ENSMUSP00000032510
Gene: ENSMUSG00000030359

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
Pfam:A2M_N 126 219 8.8e-22 PFAM
low complexity region 327 338 N/A INTRINSIC
A2M_N_2 458 606 6.18e-40 SMART
A2M 750 840 2.27e-38 SMART
Pfam:Thiol-ester_cl 973 1002 5.7e-19 PFAM
Pfam:A2M_comp 1022 1284 1.6e-93 PFAM
A2M_recep 1395 1482 6.47e-43 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112132
SMART Domains Protein: ENSMUSP00000107760
Gene: ENSMUSG00000030359

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
Pfam:A2M_N 126 219 3.2e-23 PFAM
low complexity region 327 338 N/A INTRINSIC
A2M_N_2 458 606 6.18e-40 SMART
A2M 750 840 2.27e-38 SMART
Pfam:Thiol-ester_cl 973 1003 4e-19 PFAM
Pfam:A2M_comp 1022 1284 2.1e-90 PFAM
A2M_recep 1395 1482 6.47e-43 SMART
Predicted Effect probably null
Transcript: ENSMUST00000143664
SMART Domains Protein: ENSMUSP00000120114
Gene: ENSMUSG00000030359

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
Pfam:A2M_N 126 212 4.8e-21 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes mutant null mice show higher bone mineral density, hypoactivity, and decreased heart rate. Mice homozygous for a different null allele show resistance to the lethal effects of endotoxin, increased susceptibility to diet-induced acute pancreatitis, and altered LPS-induced febrile and cytokine responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T C 16: 3,906,175 R162G probably benign Het
Adamtsl4 T A 3: 95,685,497 probably benign Het
Adgrv1 A T 13: 81,563,779 L306H probably damaging Het
Aknad1 T A 3: 108,752,136 Y155* probably null Het
Aldh6a1 C T 12: 84,441,848 R88H possibly damaging Het
Apc2 G C 10: 80,311,345 K715N probably damaging Het
Arhgap45 G A 10: 80,028,977 V798M probably damaging Het
BC037034 T C 5: 138,261,866 I338V probably benign Het
Calcrl T C 2: 84,333,537 T437A probably benign Het
Cdan1 A G 2: 120,730,739 F183L probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntnap4 A G 8: 112,881,830 E1294G possibly damaging Het
Crybg3 C A 16: 59,530,198 G2607V probably damaging Het
Dhx29 G T 13: 112,935,598 probably null Het
Dmrtb1 T A 4: 107,684,125 H13L probably damaging Het
Echdc2 A G 4: 108,173,809 M162V probably benign Het
Entpd8 A G 2: 25,084,974 D439G possibly damaging Het
Fastkd2 C G 1: 63,745,887 H477Q probably null Het
Fbrs A G 7: 127,485,357 E517G probably damaging Het
Gchfr A G 2: 119,172,021 T71A possibly damaging Het
Hecw1 A T 13: 14,377,907 C35S probably damaging Het
Izumo1r C T 9: 14,901,802 R58H probably benign Het
Kif13a T C 13: 46,752,856 E537G possibly damaging Het
Kif13b G A 14: 64,782,341 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lnpk A T 2: 74,547,996 D140E probably damaging Het
Ltbp1 A G 17: 75,252,367 M284V probably benign Het
Me3 A T 7: 89,845,842 T323S possibly damaging Het
Mtus1 A G 8: 41,082,858 V607A probably damaging Het
Myh14 A T 7: 44,655,694 probably null Het
Myo1h T A 5: 114,347,435 C545* probably null Het
Nbn T A 4: 15,964,289 D121E probably damaging Het
Nox4 A G 7: 87,370,023 Y408C probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1153 G A 2: 87,896,942 A248T probably benign Het
Olfr1491 A G 19: 13,705,202 D125G probably damaging Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Osbpl5 T C 7: 143,709,202 T150A possibly damaging Het
Pgap3 C A 11: 98,390,053 M265I probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd2l2 A T 18: 34,427,393 N351I possibly damaging Het
Prkdc T A 16: 15,675,328 Y700N probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptor A T 11: 119,896,001 Q1264L probably benign Het
Scnn1a T C 6: 125,322,140 F61S probably damaging Het
Tenm2 C A 11: 36,106,783 W825C probably damaging Het
Tex264 A T 9: 106,681,917 I70N possibly damaging Het
Tns2 G T 15: 102,111,210 D504Y probably damaging Het
Trpc2 T A 7: 102,084,240 F132Y probably damaging Het
Trpm4 A G 7: 45,308,597 F816S probably damaging Het
Uqcc1 G A 2: 155,921,721 Q5* probably null Het
Usp36 G T 11: 118,284,945 T130N probably damaging Het
Vav1 A G 17: 57,297,252 M165V probably benign Het
Vmn1r64 A T 7: 5,883,804 F247I probably damaging Het
Vmn2r26 G C 6: 124,039,747 R390P probably benign Het
Vmn2r57 G T 7: 41,400,124 H734N probably benign Het
Wfdc16 G T 2: 164,635,923 H69N possibly damaging Het
Zfp316 C T 5: 143,253,562 E901K probably damaging Het
Zfp334 T C 2: 165,381,799 E108G probably damaging Het
Zfp407 T C 18: 84,209,638 S1949G probably benign Het
Zfp408 A G 2: 91,646,128 L227P probably benign Het
Zfp560 T C 9: 20,347,991 H525R possibly damaging Het
Zfp609 G A 9: 65,704,472 A403V possibly damaging Het
Other mutations in Pzp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Pzp APN 6 128516909 missense probably benign 0.25
IGL01470:Pzp APN 6 128521124 missense probably benign 0.05
IGL01753:Pzp APN 6 128502183 missense possibly damaging 0.78
IGL01878:Pzp APN 6 128495298 missense probably damaging 1.00
IGL02307:Pzp APN 6 128489086 nonsense probably null
IGL02338:Pzp APN 6 128486170 missense probably benign 0.07
IGL02546:Pzp APN 6 128494699 splice site probably benign
IGL02598:Pzp APN 6 128487457 missense probably benign 0.00
IGL02699:Pzp APN 6 128487401 critical splice donor site probably null
P4748:Pzp UTSW 6 128490089 missense probably damaging 1.00
R0157:Pzp UTSW 6 128523976 nonsense probably null
R0195:Pzp UTSW 6 128487478 missense probably damaging 1.00
R0238:Pzp UTSW 6 128489156 splice site probably benign
R0239:Pzp UTSW 6 128489156 splice site probably benign
R0271:Pzp UTSW 6 128519514 missense probably damaging 1.00
R0299:Pzp UTSW 6 128495330 splice site probably benign
R0744:Pzp UTSW 6 128516195 unclassified probably benign
R0968:Pzp UTSW 6 128525145 missense probably benign 0.00
R1037:Pzp UTSW 6 128519426 missense probably benign 0.01
R1074:Pzp UTSW 6 128487924 missense probably benign 0.20
R1469:Pzp UTSW 6 128512356 missense probably benign 0.04
R1469:Pzp UTSW 6 128512356 missense probably benign 0.04
R1646:Pzp UTSW 6 128503555 missense probably benign 0.33
R1770:Pzp UTSW 6 128485617 missense probably damaging 1.00
R1777:Pzp UTSW 6 128490572 missense possibly damaging 0.85
R1786:Pzp UTSW 6 128491161 splice site probably null
R1854:Pzp UTSW 6 128502225 missense probably damaging 1.00
R2001:Pzp UTSW 6 128516120 missense probably benign 0.01
R2060:Pzp UTSW 6 128483710 missense probably benign 0.45
R2081:Pzp UTSW 6 128519420 missense probably benign 0.00
R2130:Pzp UTSW 6 128491161 splice site probably null
R2131:Pzp UTSW 6 128491161 splice site probably null
R2160:Pzp UTSW 6 128525276 missense probably damaging 1.00
R2168:Pzp UTSW 6 128488047 missense probably damaging 0.98
R2328:Pzp UTSW 6 128510390 missense possibly damaging 0.79
R2441:Pzp UTSW 6 128489768 nonsense probably null
R2866:Pzp UTSW 6 128525264 missense possibly damaging 0.76
R2869:Pzp UTSW 6 128485556 critical splice donor site probably null
R2869:Pzp UTSW 6 128485556 critical splice donor site probably null
R2870:Pzp UTSW 6 128485556 critical splice donor site probably null
R2870:Pzp UTSW 6 128485556 critical splice donor site probably null
R2873:Pzp UTSW 6 128485556 critical splice donor site probably null
R2876:Pzp UTSW 6 128491550 missense probably damaging 1.00
R3404:Pzp UTSW 6 128513806 missense probably damaging 1.00
R4452:Pzp UTSW 6 128491240 missense probably damaging 1.00
R4461:Pzp UTSW 6 128524040 missense probably benign 0.02
R5103:Pzp UTSW 6 128502229 missense probably benign 0.04
R5193:Pzp UTSW 6 128502334 missense probably benign 0.00
R5425:Pzp UTSW 6 128489048 missense probably damaging 0.97
R5465:Pzp UTSW 6 128486961 missense probably damaging 1.00
R5590:Pzp UTSW 6 128523796 missense probably damaging 1.00
R5656:Pzp UTSW 6 128490072 missense probably damaging 0.99
R5697:Pzp UTSW 6 128525189 missense probably benign 0.03
R5854:Pzp UTSW 6 128506869 missense probably benign 0.01
R5994:Pzp UTSW 6 128491597 missense probably damaging 1.00
R6042:Pzp UTSW 6 128524014 missense possibly damaging 0.75
R6054:Pzp UTSW 6 128513764 missense probably benign 0.03
R6153:Pzp UTSW 6 128489016 missense probably benign
R6465:Pzp UTSW 6 128491619 missense probably damaging 1.00
R6719:Pzp UTSW 6 128524083 missense probably benign 0.17
R6722:Pzp UTSW 6 128487954 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGGCGAAAACTGATGTCCAC -3'
(R):5'- ACAGATCCCTGTAGACTCTGAGCAC -3'

Sequencing Primer
(F):5'- TGATGTCCACAGAAACAACTCG -3'
(R):5'- AGTGAATCCGAACTTACTCTCTACG -3'
Posted On2014-04-13