Incidental Mutation 'R1579:Trpm4'
ID171288
Institutional Source Beutler Lab
Gene Symbol Trpm4
Ensembl Gene ENSMUSG00000038260
Gene Nametransient receptor potential cation channel, subfamily M, member 4
SynonymsLTRPC4, TRPM4B, 1110030C19Rik
MMRRC Submission 039616-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R1579 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45302632-45333780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45308597 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 816 (F816S)
Ref Sequence ENSEMBL: ENSMUSP00000147793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042194] [ENSMUST00000209506] [ENSMUST00000210311] [ENSMUST00000211431] [ENSMUST00000211743]
Predicted Effect probably damaging
Transcript: ENSMUST00000042194
AA Change: F963S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040367
Gene: ENSMUSG00000038260
AA Change: F963S

DomainStartEndE-ValueType
low complexity region 118 131 N/A INTRINSIC
SCOP:d1awcb_ 378 465 2e-3 SMART
low complexity region 600 612 N/A INTRINSIC
low complexity region 637 645 N/A INTRINSIC
transmembrane domain 688 710 N/A INTRINSIC
Pfam:Ion_trans 781 1051 1.8e-13 PFAM
low complexity region 1089 1096 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209239
Predicted Effect probably benign
Transcript: ENSMUST00000209506
Predicted Effect probably benign
Transcript: ENSMUST00000210311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210639
Predicted Effect probably benign
Transcript: ENSMUST00000211431
Predicted Effect probably damaging
Transcript: ENSMUST00000211743
AA Change: F816S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a calcium-activated nonselective ion channel that mediates transport of monovalent cations across membranes, thereby depolarizing the membrane. The activity of the encoded protein increases with increasing intracellular calcium concentration, but this channel does not transport calcium. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display increased Ca2+ influx and IgE-dependent mast cell activation, increased vascular permeability, and enhanced acute anaphylactic responses. Mice homozygous for a different knock-out allele show Ca2+ overload and impaired dendritic cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T C 16: 3,906,175 R162G probably benign Het
Adamtsl4 T A 3: 95,685,497 probably benign Het
Adgrv1 A T 13: 81,563,779 L306H probably damaging Het
Aknad1 T A 3: 108,752,136 Y155* probably null Het
Aldh6a1 C T 12: 84,441,848 R88H possibly damaging Het
Apc2 G C 10: 80,311,345 K715N probably damaging Het
Arhgap45 G A 10: 80,028,977 V798M probably damaging Het
BC037034 T C 5: 138,261,866 I338V probably benign Het
Calcrl T C 2: 84,333,537 T437A probably benign Het
Cdan1 A G 2: 120,730,739 F183L probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntnap4 A G 8: 112,881,830 E1294G possibly damaging Het
Crybg3 C A 16: 59,530,198 G2607V probably damaging Het
Dhx29 G T 13: 112,935,598 probably null Het
Dmrtb1 T A 4: 107,684,125 H13L probably damaging Het
Echdc2 A G 4: 108,173,809 M162V probably benign Het
Entpd8 A G 2: 25,084,974 D439G possibly damaging Het
Fastkd2 C G 1: 63,745,887 H477Q probably null Het
Fbrs A G 7: 127,485,357 E517G probably damaging Het
Gchfr A G 2: 119,172,021 T71A possibly damaging Het
Hecw1 A T 13: 14,377,907 C35S probably damaging Het
Izumo1r C T 9: 14,901,802 R58H probably benign Het
Kif13a T C 13: 46,752,856 E537G possibly damaging Het
Kif13b G A 14: 64,782,341 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lnpk A T 2: 74,547,996 D140E probably damaging Het
Ltbp1 A G 17: 75,252,367 M284V probably benign Het
Me3 A T 7: 89,845,842 T323S possibly damaging Het
Mtus1 A G 8: 41,082,858 V607A probably damaging Het
Myh14 A T 7: 44,655,694 probably null Het
Myo1h T A 5: 114,347,435 C545* probably null Het
Nbn T A 4: 15,964,289 D121E probably damaging Het
Nox4 A G 7: 87,370,023 Y408C probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1153 G A 2: 87,896,942 A248T probably benign Het
Olfr1491 A G 19: 13,705,202 D125G probably damaging Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Osbpl5 T C 7: 143,709,202 T150A possibly damaging Het
Pgap3 C A 11: 98,390,053 M265I probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd2l2 A T 18: 34,427,393 N351I possibly damaging Het
Prkdc T A 16: 15,675,328 Y700N probably benign Het
Pzp A G 6: 128,523,968 probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptor A T 11: 119,896,001 Q1264L probably benign Het
Scnn1a T C 6: 125,322,140 F61S probably damaging Het
Tenm2 C A 11: 36,106,783 W825C probably damaging Het
Tex264 A T 9: 106,681,917 I70N possibly damaging Het
Tns2 G T 15: 102,111,210 D504Y probably damaging Het
Trpc2 T A 7: 102,084,240 F132Y probably damaging Het
Uqcc1 G A 2: 155,921,721 Q5* probably null Het
Usp36 G T 11: 118,284,945 T130N probably damaging Het
Vav1 A G 17: 57,297,252 M165V probably benign Het
Vmn1r64 A T 7: 5,883,804 F247I probably damaging Het
Vmn2r26 G C 6: 124,039,747 R390P probably benign Het
Vmn2r57 G T 7: 41,400,124 H734N probably benign Het
Wfdc16 G T 2: 164,635,923 H69N possibly damaging Het
Zfp316 C T 5: 143,253,562 E901K probably damaging Het
Zfp334 T C 2: 165,381,799 E108G probably damaging Het
Zfp407 T C 18: 84,209,638 S1949G probably benign Het
Zfp408 A G 2: 91,646,128 L227P probably benign Het
Zfp560 T C 9: 20,347,991 H525R possibly damaging Het
Zfp609 G A 9: 65,704,472 A403V possibly damaging Het
Other mutations in Trpm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Trpm4 APN 7 45318349 missense probably benign
IGL01327:Trpm4 APN 7 45315073 missense probably damaging 1.00
IGL02069:Trpm4 APN 7 45319294 missense probably damaging 1.00
IGL02124:Trpm4 APN 7 45310523 missense probably damaging 1.00
IGL02141:Trpm4 APN 7 45318179 splice site probably null
IGL02333:Trpm4 APN 7 45322115 missense possibly damaging 0.85
IGL02338:Trpm4 APN 7 45326998 missense probably damaging 1.00
IGL02741:Trpm4 APN 7 45318488 missense possibly damaging 0.82
R0041:Trpm4 UTSW 7 45304946 critical splice donor site probably null
R0106:Trpm4 UTSW 7 45319240 critical splice donor site probably null
R0270:Trpm4 UTSW 7 45319253 missense possibly damaging 0.45
R0279:Trpm4 UTSW 7 45322048 missense probably damaging 0.99
R0309:Trpm4 UTSW 7 45308706 missense probably damaging 1.00
R0539:Trpm4 UTSW 7 45305472 missense probably damaging 0.99
R0969:Trpm4 UTSW 7 45327907 intron probably benign
R1454:Trpm4 UTSW 7 45317056 missense probably damaging 0.99
R1512:Trpm4 UTSW 7 45315044 missense probably benign 0.07
R1768:Trpm4 UTSW 7 45308612 missense probably damaging 0.97
R2847:Trpm4 UTSW 7 45310598 missense probably damaging 1.00
R3883:Trpm4 UTSW 7 45321998 critical splice donor site probably null
R3884:Trpm4 UTSW 7 45321998 critical splice donor site probably null
R4895:Trpm4 UTSW 7 45318058 missense probably damaging 0.98
R5056:Trpm4 UTSW 7 45308630 missense probably damaging 0.98
R5060:Trpm4 UTSW 7 45321834 missense probably damaging 1.00
R5069:Trpm4 UTSW 7 45310469 missense probably damaging 1.00
R5560:Trpm4 UTSW 7 45310332 missense probably damaging 1.00
R5783:Trpm4 UTSW 7 45310389 missense probably benign
R5874:Trpm4 UTSW 7 45327749 missense probably damaging 1.00
R6176:Trpm4 UTSW 7 45326676 missense probably damaging 1.00
R6302:Trpm4 UTSW 7 45327719 critical splice donor site probably null
R6431:Trpm4 UTSW 7 45326568 missense possibly damaging 0.79
R6827:Trpm4 UTSW 7 45318628 missense possibly damaging 0.89
R6845:Trpm4 UTSW 7 45322329 missense possibly damaging 0.88
R6950:Trpm4 UTSW 7 45319280 missense probably damaging 0.97
X0018:Trpm4 UTSW 7 45314634 missense possibly damaging 0.61
X0022:Trpm4 UTSW 7 45310511 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGGCATACTGGGACACACAGG -3'
(R):5'- AAAGGGCTGGGTCATTTCACCCAC -3'

Sequencing Primer
(F):5'- CCATTGAGCAGTTACCTGGAATC -3'
(R):5'- GGGTCATTTCACCCACATCTTC -3'
Posted On2014-04-13