Incidental Mutation 'R1579:Olfr653'
ID171292
Institutional Source Beutler Lab
Gene Symbol Olfr653
Ensembl Gene ENSMUSG00000073926
Gene Nameolfactory receptor 653
SynonymsMOR33-1, GA_x6K02T2PBJ9-7206970-7207923
MMRRC Submission 039616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R1579 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104577314-104584117 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 104580061 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 138 (Y138*)
Ref Sequence ENSEMBL: ENSMUSP00000149192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098174] [ENSMUST00000215585] [ENSMUST00000217466]
Predicted Effect probably null
Transcript: ENSMUST00000098174
AA Change: Y138*
SMART Domains Protein: ENSMUSP00000095776
Gene: ENSMUSG00000073926
AA Change: Y138*

DomainStartEndE-ValueType
Pfam:7tm_4 37 316 2.2e-111 PFAM
Pfam:7TM_GPCR_Srsx 41 179 4.6e-10 PFAM
Pfam:7tm_1 47 298 5.9e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215585
AA Change: Y138*
Predicted Effect probably null
Transcript: ENSMUST00000217466
AA Change: Y138*
Meta Mutation Damage Score 0.6416 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T C 16: 3,906,175 R162G probably benign Het
Adamtsl4 T A 3: 95,685,497 probably benign Het
Adgrv1 A T 13: 81,563,779 L306H probably damaging Het
Aknad1 T A 3: 108,752,136 Y155* probably null Het
Aldh6a1 C T 12: 84,441,848 R88H possibly damaging Het
Apc2 G C 10: 80,311,345 K715N probably damaging Het
Arhgap45 G A 10: 80,028,977 V798M probably damaging Het
BC037034 T C 5: 138,261,866 I338V probably benign Het
Calcrl T C 2: 84,333,537 T437A probably benign Het
Cdan1 A G 2: 120,730,739 F183L probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntnap4 A G 8: 112,881,830 E1294G possibly damaging Het
Crybg3 C A 16: 59,530,198 G2607V probably damaging Het
Dhx29 G T 13: 112,935,598 probably null Het
Dmrtb1 T A 4: 107,684,125 H13L probably damaging Het
Echdc2 A G 4: 108,173,809 M162V probably benign Het
Entpd8 A G 2: 25,084,974 D439G possibly damaging Het
Fastkd2 C G 1: 63,745,887 H477Q probably null Het
Fbrs A G 7: 127,485,357 E517G probably damaging Het
Gchfr A G 2: 119,172,021 T71A possibly damaging Het
Hecw1 A T 13: 14,377,907 C35S probably damaging Het
Izumo1r C T 9: 14,901,802 R58H probably benign Het
Kif13a T C 13: 46,752,856 E537G possibly damaging Het
Kif13b G A 14: 64,782,341 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lnpk A T 2: 74,547,996 D140E probably damaging Het
Ltbp1 A G 17: 75,252,367 M284V probably benign Het
Me3 A T 7: 89,845,842 T323S possibly damaging Het
Mtus1 A G 8: 41,082,858 V607A probably damaging Het
Myh14 A T 7: 44,655,694 probably null Het
Myo1h T A 5: 114,347,435 C545* probably null Het
Nbn T A 4: 15,964,289 D121E probably damaging Het
Nox4 A G 7: 87,370,023 Y408C probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1153 G A 2: 87,896,942 A248T probably benign Het
Olfr1491 A G 19: 13,705,202 D125G probably damaging Het
Osbpl5 T C 7: 143,709,202 T150A possibly damaging Het
Pgap3 C A 11: 98,390,053 M265I probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd2l2 A T 18: 34,427,393 N351I possibly damaging Het
Prkdc T A 16: 15,675,328 Y700N probably benign Het
Pzp A G 6: 128,523,968 probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptor A T 11: 119,896,001 Q1264L probably benign Het
Scnn1a T C 6: 125,322,140 F61S probably damaging Het
Tenm2 C A 11: 36,106,783 W825C probably damaging Het
Tex264 A T 9: 106,681,917 I70N possibly damaging Het
Tns2 G T 15: 102,111,210 D504Y probably damaging Het
Trpc2 T A 7: 102,084,240 F132Y probably damaging Het
Trpm4 A G 7: 45,308,597 F816S probably damaging Het
Uqcc1 G A 2: 155,921,721 Q5* probably null Het
Usp36 G T 11: 118,284,945 T130N probably damaging Het
Vav1 A G 17: 57,297,252 M165V probably benign Het
Vmn1r64 A T 7: 5,883,804 F247I probably damaging Het
Vmn2r26 G C 6: 124,039,747 R390P probably benign Het
Vmn2r57 G T 7: 41,400,124 H734N probably benign Het
Wfdc16 G T 2: 164,635,923 H69N possibly damaging Het
Zfp316 C T 5: 143,253,562 E901K probably damaging Het
Zfp334 T C 2: 165,381,799 E108G probably damaging Het
Zfp407 T C 18: 84,209,638 S1949G probably benign Het
Zfp408 A G 2: 91,646,128 L227P probably benign Het
Zfp560 T C 9: 20,347,991 H525R possibly damaging Het
Zfp609 G A 9: 65,704,472 A403V possibly damaging Het
Other mutations in Olfr653
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Olfr653 APN 7 104579943 missense probably damaging 1.00
I2288:Olfr653 UTSW 7 104580386 missense probably damaging 1.00
PIT4131001:Olfr653 UTSW 7 104580030 missense probably damaging 0.99
R0325:Olfr653 UTSW 7 104580360 missense probably damaging 1.00
R1599:Olfr653 UTSW 7 104579648 start codon destroyed probably null
R1956:Olfr653 UTSW 7 104579909 missense probably damaging 1.00
R2134:Olfr653 UTSW 7 104579641 start gained probably benign
R2418:Olfr653 UTSW 7 104579934 missense probably benign 0.00
R2483:Olfr653 UTSW 7 104579942 missense probably damaging 1.00
R3623:Olfr653 UTSW 7 104579942 missense probably damaging 1.00
R4049:Olfr653 UTSW 7 104580368 missense probably benign
R4755:Olfr653 UTSW 7 104580061 nonsense probably null
R4757:Olfr653 UTSW 7 104580197 missense possibly damaging 0.95
R4828:Olfr653 UTSW 7 104579973 missense possibly damaging 0.62
R4842:Olfr653 UTSW 7 104580215 missense probably benign 0.45
R5496:Olfr653 UTSW 7 104580494 missense probably damaging 1.00
R6830:Olfr653 UTSW 7 104580240 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTATCCCCAATGAAACTGCC -3'
(R):5'- GCTATGCCCATGTGCTCACAGTAAG -3'

Sequencing Primer
(F):5'- CTTGGAATCCCTGGGATGCAG -3'
(R):5'- GTCCACAGAAGGGTAAACGTT -3'
Posted On2014-04-13