Incidental Mutation 'R1579:Apc2'
ID171305
Institutional Source Beutler Lab
Gene Symbol Apc2
Ensembl Gene ENSMUSG00000020135
Gene Nameadenomatosis polyposis coli 2
SynonymsAPCL
MMRRC Submission 039616-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.503) question?
Stock #R1579 (G1)
Quality Score152
Status Not validated
Chromosome10
Chromosomal Location80295977-80318263 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 80311345 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 715 (K715N)
Ref Sequence ENSEMBL: ENSMUSP00000020349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020349] [ENSMUST00000105359]
Predicted Effect probably damaging
Transcript: ENSMUST00000020349
AA Change: K715N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020349
Gene: ENSMUSG00000020135
AA Change: K715N

DomainStartEndE-ValueType
PDB:1DEB|B 4 57 9e-17 PDB
Pfam:Suppressor_APC 123 205 1.3e-28 PFAM
coiled coil region 214 236 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
ARM 300 355 2.95e0 SMART
ARM 417 468 2.22e-2 SMART
ARM 470 511 3.22e0 SMART
ARM 513 555 3.56e-1 SMART
ARM 557 602 2.1e1 SMART
ARM 607 647 1.82e-7 SMART
Blast:ARM 649 689 6e-18 BLAST
low complexity region 772 792 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1087 1103 N/A INTRINSIC
Pfam:APC_crr 1134 1159 4.4e-9 PFAM
low complexity region 1197 1208 N/A INTRINSIC
Pfam:APC_crr 1244 1269 4.1e-8 PFAM
Pfam:SAMP 1323 1343 2.1e-10 PFAM
Pfam:APC_crr 1369 1394 5.8e-8 PFAM
low complexity region 1500 1516 N/A INTRINSIC
Pfam:APC_crr 1540 1565 5.7e-8 PFAM
Pfam:SAMP 1594 1613 8.8e-11 PFAM
low complexity region 1673 1699 N/A INTRINSIC
Pfam:APC_basic 1757 2093 1.1e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105359
AA Change: K744N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100996
Gene: ENSMUSG00000020135
AA Change: K744N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:APC_N_CC 30 81 2.7e-34 PFAM
Pfam:Suppressor_APC 148 228 1.4e-27 PFAM
coiled coil region 238 260 N/A INTRINSIC
low complexity region 266 285 N/A INTRINSIC
ARM 324 379 2.95e0 SMART
ARM 446 497 2.22e-2 SMART
ARM 499 540 3.22e0 SMART
ARM 542 584 3.56e-1 SMART
ARM 586 631 2.1e1 SMART
ARM 636 676 1.82e-7 SMART
Blast:ARM 678 718 6e-18 BLAST
Pfam:Arm_APC_u3 719 977 1.1e-26 PFAM
low complexity region 1000 1009 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
Pfam:APC_crr 1164 1187 9.3e-8 PFAM
low complexity region 1226 1237 N/A INTRINSIC
Pfam:APC_crr 1274 1297 7.9e-10 PFAM
Pfam:APC_crr 1399 1423 1.3e-9 PFAM
low complexity region 1529 1545 N/A INTRINSIC
low complexity region 1585 1603 N/A INTRINSIC
Pfam:SAMP 1624 1642 1.3e-11 PFAM
low complexity region 1702 1728 N/A INTRINSIC
Pfam:APC_basic 1786 2122 1.3e-122 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display gradual postnatal growth retardation, abnormal lamination of the cerebral cortex, hippocampus, olfactory bulb and cerebellum, impaired neuronal migration and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T C 16: 3,906,175 R162G probably benign Het
Adamtsl4 T A 3: 95,685,497 probably benign Het
Adgrv1 A T 13: 81,563,779 L306H probably damaging Het
Aknad1 T A 3: 108,752,136 Y155* probably null Het
Aldh6a1 C T 12: 84,441,848 R88H possibly damaging Het
Arhgap45 G A 10: 80,028,977 V798M probably damaging Het
BC037034 T C 5: 138,261,866 I338V probably benign Het
Calcrl T C 2: 84,333,537 T437A probably benign Het
Cdan1 A G 2: 120,730,739 F183L probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntnap4 A G 8: 112,881,830 E1294G possibly damaging Het
Crybg3 C A 16: 59,530,198 G2607V probably damaging Het
Dhx29 G T 13: 112,935,598 probably null Het
Dmrtb1 T A 4: 107,684,125 H13L probably damaging Het
Echdc2 A G 4: 108,173,809 M162V probably benign Het
Entpd8 A G 2: 25,084,974 D439G possibly damaging Het
Fastkd2 C G 1: 63,745,887 H477Q probably null Het
Fbrs A G 7: 127,485,357 E517G probably damaging Het
Gchfr A G 2: 119,172,021 T71A possibly damaging Het
Hecw1 A T 13: 14,377,907 C35S probably damaging Het
Izumo1r C T 9: 14,901,802 R58H probably benign Het
Kif13a T C 13: 46,752,856 E537G possibly damaging Het
Kif13b G A 14: 64,782,341 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lnpk A T 2: 74,547,996 D140E probably damaging Het
Ltbp1 A G 17: 75,252,367 M284V probably benign Het
Me3 A T 7: 89,845,842 T323S possibly damaging Het
Mtus1 A G 8: 41,082,858 V607A probably damaging Het
Myh14 A T 7: 44,655,694 probably null Het
Myo1h T A 5: 114,347,435 C545* probably null Het
Nbn T A 4: 15,964,289 D121E probably damaging Het
Nox4 A G 7: 87,370,023 Y408C probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1153 G A 2: 87,896,942 A248T probably benign Het
Olfr1491 A G 19: 13,705,202 D125G probably damaging Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Osbpl5 T C 7: 143,709,202 T150A possibly damaging Het
Pgap3 C A 11: 98,390,053 M265I probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd2l2 A T 18: 34,427,393 N351I possibly damaging Het
Prkdc T A 16: 15,675,328 Y700N probably benign Het
Pzp A G 6: 128,523,968 probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptor A T 11: 119,896,001 Q1264L probably benign Het
Scnn1a T C 6: 125,322,140 F61S probably damaging Het
Tenm2 C A 11: 36,106,783 W825C probably damaging Het
Tex264 A T 9: 106,681,917 I70N possibly damaging Het
Tns2 G T 15: 102,111,210 D504Y probably damaging Het
Trpc2 T A 7: 102,084,240 F132Y probably damaging Het
Trpm4 A G 7: 45,308,597 F816S probably damaging Het
Uqcc1 G A 2: 155,921,721 Q5* probably null Het
Usp36 G T 11: 118,284,945 T130N probably damaging Het
Vav1 A G 17: 57,297,252 M165V probably benign Het
Vmn1r64 A T 7: 5,883,804 F247I probably damaging Het
Vmn2r26 G C 6: 124,039,747 R390P probably benign Het
Vmn2r57 G T 7: 41,400,124 H734N probably benign Het
Wfdc16 G T 2: 164,635,923 H69N possibly damaging Het
Zfp316 C T 5: 143,253,562 E901K probably damaging Het
Zfp334 T C 2: 165,381,799 E108G probably damaging Het
Zfp407 T C 18: 84,209,638 S1949G probably benign Het
Zfp408 A G 2: 91,646,128 L227P probably benign Het
Zfp560 T C 9: 20,347,991 H525R possibly damaging Het
Zfp609 G A 9: 65,704,472 A403V possibly damaging Het
Other mutations in Apc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Apc2 APN 10 80311986 missense probably damaging 1.00
IGL01154:Apc2 APN 10 80313069 missense possibly damaging 0.90
IGL01411:Apc2 APN 10 80315078 missense probably damaging 0.99
IGL01598:Apc2 APN 10 80313048 missense probably damaging 1.00
IGL01621:Apc2 APN 10 80306201 missense probably damaging 1.00
IGL01720:Apc2 APN 10 80314499 missense probably benign 0.01
IGL01837:Apc2 APN 10 80314658 missense probably benign 0.24
IGL01933:Apc2 APN 10 80311740 missense probably damaging 1.00
IGL02243:Apc2 APN 10 80302341 missense probably damaging 1.00
IGL02292:Apc2 APN 10 80302424 missense possibly damaging 0.59
IGL02956:Apc2 APN 10 80306375 missense probably damaging 1.00
IGL03081:Apc2 APN 10 80312252 missense probably damaging 1.00
IGL03172:Apc2 APN 10 80313386 missense probably damaging 0.98
LCD18:Apc2 UTSW 10 80299974 intron probably benign
R0278:Apc2 UTSW 10 80312813 missense possibly damaging 0.90
R0501:Apc2 UTSW 10 80315124 missense probably damaging 1.00
R0594:Apc2 UTSW 10 80306256 nonsense probably null
R0607:Apc2 UTSW 10 80314101 missense probably benign
R0624:Apc2 UTSW 10 80314583 missense probably benign 0.00
R0633:Apc2 UTSW 10 80307455 missense probably damaging 0.99
R0638:Apc2 UTSW 10 80304967 missense probably damaging 0.99
R0647:Apc2 UTSW 10 80304928 missense probably damaging 1.00
R0830:Apc2 UTSW 10 80315405 missense probably damaging 1.00
R1071:Apc2 UTSW 10 80311502 missense probably damaging 1.00
R1221:Apc2 UTSW 10 80306380 missense probably damaging 1.00
R1432:Apc2 UTSW 10 80312349 missense probably benign 0.00
R1654:Apc2 UTSW 10 80301842 missense possibly damaging 0.75
R1700:Apc2 UTSW 10 80312769 missense probably damaging 1.00
R1774:Apc2 UTSW 10 80309130 missense probably damaging 1.00
R1864:Apc2 UTSW 10 80313648 missense probably damaging 1.00
R1908:Apc2 UTSW 10 80314844 missense probably benign 0.05
R1915:Apc2 UTSW 10 80315867 missense probably benign
R1999:Apc2 UTSW 10 80309160 missense probably damaging 1.00
R2050:Apc2 UTSW 10 80307609 intron probably null
R2219:Apc2 UTSW 10 80309109 missense probably benign 0.41
R2393:Apc2 UTSW 10 80313069 missense possibly damaging 0.90
R3862:Apc2 UTSW 10 80307559 missense possibly damaging 0.82
R3900:Apc2 UTSW 10 80295972 unclassified probably null
R3901:Apc2 UTSW 10 80315088 missense possibly damaging 0.94
R3952:Apc2 UTSW 10 80314484 missense probably damaging 1.00
R4009:Apc2 UTSW 10 80313592 missense probably benign 0.00
R4090:Apc2 UTSW 10 80305544 missense probably damaging 0.97
R4695:Apc2 UTSW 10 80311043 missense probably damaging 1.00
R4754:Apc2 UTSW 10 80314358 missense probably benign 0.01
R4807:Apc2 UTSW 10 80314362 missense probably benign 0.13
R4886:Apc2 UTSW 10 80314213 missense probably damaging 1.00
R4964:Apc2 UTSW 10 80314007 missense probably benign 0.14
R5056:Apc2 UTSW 10 80301314 missense probably benign
R5057:Apc2 UTSW 10 80309069 missense probably damaging 0.99
R5165:Apc2 UTSW 10 80315850 missense probably damaging 0.99
R5241:Apc2 UTSW 10 80312234 missense probably benign
R5649:Apc2 UTSW 10 80314138 missense probably damaging 1.00
R5924:Apc2 UTSW 10 80312150 missense probably damaging 1.00
R6124:Apc2 UTSW 10 80306351 missense probably damaging 0.98
R6218:Apc2 UTSW 10 80306420 missense probably damaging 0.98
R6376:Apc2 UTSW 10 80312654 missense probably damaging 1.00
R6490:Apc2 UTSW 10 80313923 missense probably benign 0.01
R6572:Apc2 UTSW 10 80311779 missense probably damaging 1.00
R6620:Apc2 UTSW 10 80313567 missense probably damaging 0.97
X0018:Apc2 UTSW 10 80312264 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCATCGTGAGCAATGCCTGTG -3'
(R):5'- TCGTCAAAGCAGCCAGAATCAGAG -3'

Sequencing Primer
(F):5'- ATCAGGAACTGTTGTGGGACC -3'
(R):5'- TCAGAGGCATAGTCCTGCAC -3'
Posted On2014-04-13