Incidental Mutation 'R1579:Tenm2'
ID171307
Institutional Source Beutler Lab
Gene Symbol Tenm2
Ensembl Gene ENSMUSG00000049336
Gene Nameteneurin transmembrane protein 2
Synonyms2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2
MMRRC Submission 039616-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1579 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location36006656-37235964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36106783 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Cysteine at position 825 (W825C)
Ref Sequence ENSEMBL: ENSMUSP00000129951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]
Predicted Effect probably damaging
Transcript: ENSMUST00000057207
AA Change: W826C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: W826C

DomainStartEndE-ValueType
Pfam:Ten_N 10 374 4.9e-177 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 738 766 9.63e0 SMART
EGF 769 797 1.25e1 SMART
EGF 800 832 1.4e0 SMART
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 2219 2230 N/A INTRINSIC
Pfam:Tox-GHH 2681 2758 1.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102801
AA Change: W825C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: W825C

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163524
AA Change: W825C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: W825C

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T C 16: 3,906,175 R162G probably benign Het
Adamtsl4 T A 3: 95,685,497 probably benign Het
Adgrv1 A T 13: 81,563,779 L306H probably damaging Het
Aknad1 T A 3: 108,752,136 Y155* probably null Het
Aldh6a1 C T 12: 84,441,848 R88H possibly damaging Het
Apc2 G C 10: 80,311,345 K715N probably damaging Het
Arhgap45 G A 10: 80,028,977 V798M probably damaging Het
BC037034 T C 5: 138,261,866 I338V probably benign Het
Calcrl T C 2: 84,333,537 T437A probably benign Het
Cdan1 A G 2: 120,730,739 F183L probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntnap4 A G 8: 112,881,830 E1294G possibly damaging Het
Crybg3 C A 16: 59,530,198 G2607V probably damaging Het
Dhx29 G T 13: 112,935,598 probably null Het
Dmrtb1 T A 4: 107,684,125 H13L probably damaging Het
Echdc2 A G 4: 108,173,809 M162V probably benign Het
Entpd8 A G 2: 25,084,974 D439G possibly damaging Het
Fastkd2 C G 1: 63,745,887 H477Q probably null Het
Fbrs A G 7: 127,485,357 E517G probably damaging Het
Gchfr A G 2: 119,172,021 T71A possibly damaging Het
Hecw1 A T 13: 14,377,907 C35S probably damaging Het
Izumo1r C T 9: 14,901,802 R58H probably benign Het
Kif13a T C 13: 46,752,856 E537G possibly damaging Het
Kif13b G A 14: 64,782,341 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lnpk A T 2: 74,547,996 D140E probably damaging Het
Ltbp1 A G 17: 75,252,367 M284V probably benign Het
Me3 A T 7: 89,845,842 T323S possibly damaging Het
Mtus1 A G 8: 41,082,858 V607A probably damaging Het
Myh14 A T 7: 44,655,694 probably null Het
Myo1h T A 5: 114,347,435 C545* probably null Het
Nbn T A 4: 15,964,289 D121E probably damaging Het
Nox4 A G 7: 87,370,023 Y408C probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1153 G A 2: 87,896,942 A248T probably benign Het
Olfr1491 A G 19: 13,705,202 D125G probably damaging Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Osbpl5 T C 7: 143,709,202 T150A possibly damaging Het
Pgap3 C A 11: 98,390,053 M265I probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd2l2 A T 18: 34,427,393 N351I possibly damaging Het
Prkdc T A 16: 15,675,328 Y700N probably benign Het
Pzp A G 6: 128,523,968 probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptor A T 11: 119,896,001 Q1264L probably benign Het
Scnn1a T C 6: 125,322,140 F61S probably damaging Het
Tex264 A T 9: 106,681,917 I70N possibly damaging Het
Tns2 G T 15: 102,111,210 D504Y probably damaging Het
Trpc2 T A 7: 102,084,240 F132Y probably damaging Het
Trpm4 A G 7: 45,308,597 F816S probably damaging Het
Uqcc1 G A 2: 155,921,721 Q5* probably null Het
Usp36 G T 11: 118,284,945 T130N probably damaging Het
Vav1 A G 17: 57,297,252 M165V probably benign Het
Vmn1r64 A T 7: 5,883,804 F247I probably damaging Het
Vmn2r26 G C 6: 124,039,747 R390P probably benign Het
Vmn2r57 G T 7: 41,400,124 H734N probably benign Het
Wfdc16 G T 2: 164,635,923 H69N possibly damaging Het
Zfp316 C T 5: 143,253,562 E901K probably damaging Het
Zfp334 T C 2: 165,381,799 E108G probably damaging Het
Zfp407 T C 18: 84,209,638 S1949G probably benign Het
Zfp408 A G 2: 91,646,128 L227P probably benign Het
Zfp560 T C 9: 20,347,991 H525R possibly damaging Het
Zfp609 G A 9: 65,704,472 A403V possibly damaging Het
Other mutations in Tenm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Tenm2 APN 11 36206899 splice site probably benign
IGL00834:Tenm2 APN 11 36024258 missense probably damaging 1.00
IGL00911:Tenm2 APN 11 36008733 nonsense probably null
IGL00937:Tenm2 APN 11 36024623 missense probably damaging 1.00
IGL01154:Tenm2 APN 11 36041544 missense probably damaging 1.00
IGL01313:Tenm2 APN 11 36024248 missense probably damaging 0.98
IGL01346:Tenm2 APN 11 36027405 nonsense probably null
IGL01539:Tenm2 APN 11 36106827 missense possibly damaging 0.89
IGL01629:Tenm2 APN 11 36864884 missense probably damaging 0.98
IGL01780:Tenm2 APN 11 36046941 missense probably benign
IGL01821:Tenm2 APN 11 36023883 missense probably damaging 0.98
IGL01988:Tenm2 APN 11 36027251 missense probably damaging 1.00
IGL02002:Tenm2 APN 11 36207095 missense probably benign
IGL02449:Tenm2 APN 11 36023622 missense probably damaging 0.99
IGL02505:Tenm2 APN 11 36051916 nonsense probably null
IGL02649:Tenm2 APN 11 36207085 missense possibly damaging 0.85
IGL02688:Tenm2 APN 11 36068458 missense probably benign 0.05
IGL02801:Tenm2 APN 11 36047030 nonsense probably null
IGL02928:Tenm2 APN 11 36027170 missense possibly damaging 0.69
IGL02940:Tenm2 APN 11 36041644 missense probably damaging 1.00
IGL03202:Tenm2 APN 11 36024548 missense probably damaging 1.00
IGL03213:Tenm2 APN 11 36023330 missense probably benign 0.05
IGL03276:Tenm2 APN 11 36072776 missense possibly damaging 0.95
IGL03296:Tenm2 APN 11 36052025 splice site probably null
IGL03381:Tenm2 APN 11 36068411 missense probably benign 0.01
IGL03398:Tenm2 APN 11 36024543 missense probably damaging 1.00
IGL02799:Tenm2 UTSW 11 36273408 missense probably damaging 1.00
R0004:Tenm2 UTSW 11 36023357 missense probably damaging 1.00
R0420:Tenm2 UTSW 11 36207124 splice site probably benign
R0537:Tenm2 UTSW 11 36163730 missense probably damaging 1.00
R0599:Tenm2 UTSW 11 36024780 missense possibly damaging 0.93
R0636:Tenm2 UTSW 11 36943976 missense probably damaging 1.00
R0693:Tenm2 UTSW 11 36024809 missense probably damaging 1.00
R0991:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R0992:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1167:Tenm2 UTSW 11 36864684 missense probably benign 0.30
R1177:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1178:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1179:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1180:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1181:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1193:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1194:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1259:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1265:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1267:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1268:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1269:Tenm2 UTSW 11 36008358 missense possibly damaging 0.64
R1270:Tenm2 UTSW 11 36041659 missense probably damaging 1.00
R1272:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1273:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1311:Tenm2 UTSW 11 36068594 splice site probably benign
R1374:Tenm2 UTSW 11 36008454 missense probably benign 0.00
R1542:Tenm2 UTSW 11 36300220 missense probably damaging 0.99
R1573:Tenm2 UTSW 11 36047069 missense probably damaging 1.00
R1697:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1722:Tenm2 UTSW 11 36008103 missense probably damaging 1.00
R1756:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1793:Tenm2 UTSW 11 36023382 missense probably damaging 0.99
R1950:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1954:Tenm2 UTSW 11 36047547 missense possibly damaging 0.87
R2025:Tenm2 UTSW 11 36047264 nonsense probably null
R2117:Tenm2 UTSW 11 36024854 missense probably damaging 1.00
R2244:Tenm2 UTSW 11 36864862 missense probably damaging 0.98
R2298:Tenm2 UTSW 11 36046777 missense possibly damaging 0.62
R2432:Tenm2 UTSW 11 36027191 missense probably damaging 1.00
R3014:Tenm2 UTSW 11 36023973 missense probably damaging 1.00
R3115:Tenm2 UTSW 11 36023366 missense probably damaging 1.00
R3684:Tenm2 UTSW 11 36051817 missense probably benign 0.00
R3685:Tenm2 UTSW 11 36051817 missense probably benign 0.00
R3705:Tenm2 UTSW 11 36068326 missense probably damaging 0.97
R3820:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3821:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3822:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3844:Tenm2 UTSW 11 36047538 missense probably damaging 0.98
R3878:Tenm2 UTSW 11 36139574 critical splice donor site probably null
R4019:Tenm2 UTSW 11 36047074 missense probably benign 0.04
R4062:Tenm2 UTSW 11 36008655 missense probably damaging 1.00
R4367:Tenm2 UTSW 11 36027398 missense probably benign
R4395:Tenm2 UTSW 11 36024624 missense probably benign 0.23
R4508:Tenm2 UTSW 11 36008345 missense possibly damaging 0.82
R4534:Tenm2 UTSW 11 36063104 missense possibly damaging 0.64
R4539:Tenm2 UTSW 11 36046780 missense probably damaging 1.00
R4644:Tenm2 UTSW 11 36047136 missense probably benign 0.00
R4661:Tenm2 UTSW 11 36024448 missense probably damaging 0.99
R4669:Tenm2 UTSW 11 36010487 missense probably damaging 1.00
R4687:Tenm2 UTSW 11 36049097 missense probably benign
R4711:Tenm2 UTSW 11 36300212 missense probably damaging 0.98
R4816:Tenm2 UTSW 11 36027290 missense probably damaging 1.00
R4843:Tenm2 UTSW 11 36024020 missense probably damaging 1.00
R4850:Tenm2 UTSW 11 36023488 nonsense probably null
R4870:Tenm2 UTSW 11 36078569 missense probably damaging 1.00
R5058:Tenm2 UTSW 11 36207080 missense possibly damaging 0.80
R5071:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5073:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5074:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5081:Tenm2 UTSW 11 36024633 missense possibly damaging 0.95
R5093:Tenm2 UTSW 11 36944162 missense probably damaging 1.00
R5170:Tenm2 UTSW 11 36024806 missense probably damaging 0.98
R5253:Tenm2 UTSW 11 36047201 nonsense probably null
R5343:Tenm2 UTSW 11 36069503 missense probably benign 0.00
R5493:Tenm2 UTSW 11 36864676 missense probably benign 0.01
R5600:Tenm2 UTSW 11 36163714 splice site probably null
R5677:Tenm2 UTSW 11 36141683 missense probably damaging 0.98
R5703:Tenm2 UTSW 11 36023799 missense probably benign 0.34
R5707:Tenm2 UTSW 11 36047182 missense possibly damaging 0.79
R6026:Tenm2 UTSW 11 36072729 critical splice donor site probably null
R6063:Tenm2 UTSW 11 36163717 critical splice donor site probably null
R6086:Tenm2 UTSW 11 36008646 missense possibly damaging 0.64
R6151:Tenm2 UTSW 11 36008783 missense probably damaging 1.00
R6169:Tenm2 UTSW 11 36139690 missense probably damaging 0.99
R6193:Tenm2 UTSW 11 36046794 missense probably damaging 1.00
R6405:Tenm2 UTSW 11 36864859 missense probably benign 0.44
R6477:Tenm2 UTSW 11 36010507 critical splice acceptor site probably null
R6607:Tenm2 UTSW 11 36063775 critical splice donor site probably null
R6668:Tenm2 UTSW 11 36046765 critical splice donor site probably null
R6825:Tenm2 UTSW 11 36046884 missense probably benign 0.02
R6883:Tenm2 UTSW 11 36023580 missense possibly damaging 0.95
X0018:Tenm2 UTSW 11 36024200 missense probably damaging 1.00
X0063:Tenm2 UTSW 11 36024730 missense probably benign
Z1088:Tenm2 UTSW 11 36273267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAACCTCTCTGCAATGATGGGTG -3'
(R):5'- ACTCTTTGGACAGCAGGTATGGGC -3'

Sequencing Primer
(F):5'- AAGTGTCCTCATGGCCTAAG -3'
(R):5'- GCCCCACTGTGAGGCTG -3'
Posted On2014-04-13