Incidental Mutation 'R1579:Tns2'
ID171320
Institutional Source Beutler Lab
Gene Symbol Tns2
Ensembl Gene ENSMUSG00000037003
Gene Nametensin 2
Synonymsnph, nep, Tenc1
MMRRC Submission 039616-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1579 (G1)
Quality Score103
Status Not validated
Chromosome15
Chromosomal Location102100413-102116401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 102111210 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 504 (D504Y)
Ref Sequence ENSEMBL: ENSMUSP00000155309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046144] [ENSMUST00000169627] [ENSMUST00000228958] [ENSMUST00000229592] [ENSMUST00000230474]
Predicted Effect probably damaging
Transcript: ENSMUST00000046144
AA Change: D512Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041087
Gene: ENSMUSG00000037003
AA Change: D512Y

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1136 1236 1.69e-16 SMART
PTB 1269 1407 6.66e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169627
AA Change: D512Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129146
Gene: ENSMUSG00000037003
AA Change: D512Y

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1129 1229 1.69e-16 SMART
PTB 1262 1400 6.66e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228958
AA Change: D512Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229097
Predicted Effect probably benign
Transcript: ENSMUST00000229592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229908
Predicted Effect probably damaging
Transcript: ENSMUST00000230474
AA Change: D504Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype Strain: 2447990
Lethality: D70-D210
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tensin family. Tensin is a focal adhesion molecule that binds to actin filaments and participates in signaling pathways. This protein plays a role in regulating cell migration. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Affected mice homozygous for a spontaneous deletion show reduced female fertility, increased blood urea nitrogen, low hematocrit, proteinuria, hypoproteinemia, hypercholesterolemia, small kidneys with a yellowish granular surface, glomerular lesions and premature death; some develop systemic edema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T C 16: 3,906,175 R162G probably benign Het
Adamtsl4 T A 3: 95,685,497 probably benign Het
Adgrv1 A T 13: 81,563,779 L306H probably damaging Het
Aknad1 T A 3: 108,752,136 Y155* probably null Het
Aldh6a1 C T 12: 84,441,848 R88H possibly damaging Het
Apc2 G C 10: 80,311,345 K715N probably damaging Het
Arhgap45 G A 10: 80,028,977 V798M probably damaging Het
BC037034 T C 5: 138,261,866 I338V probably benign Het
Calcrl T C 2: 84,333,537 T437A probably benign Het
Cdan1 A G 2: 120,730,739 F183L probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntnap4 A G 8: 112,881,830 E1294G possibly damaging Het
Crybg3 C A 16: 59,530,198 G2607V probably damaging Het
Dhx29 G T 13: 112,935,598 probably null Het
Dmrtb1 T A 4: 107,684,125 H13L probably damaging Het
Echdc2 A G 4: 108,173,809 M162V probably benign Het
Entpd8 A G 2: 25,084,974 D439G possibly damaging Het
Fastkd2 C G 1: 63,745,887 H477Q probably null Het
Fbrs A G 7: 127,485,357 E517G probably damaging Het
Gchfr A G 2: 119,172,021 T71A possibly damaging Het
Hecw1 A T 13: 14,377,907 C35S probably damaging Het
Izumo1r C T 9: 14,901,802 R58H probably benign Het
Kif13a T C 13: 46,752,856 E537G possibly damaging Het
Kif13b G A 14: 64,782,341 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lnpk A T 2: 74,547,996 D140E probably damaging Het
Ltbp1 A G 17: 75,252,367 M284V probably benign Het
Me3 A T 7: 89,845,842 T323S possibly damaging Het
Mtus1 A G 8: 41,082,858 V607A probably damaging Het
Myh14 A T 7: 44,655,694 probably null Het
Myo1h T A 5: 114,347,435 C545* probably null Het
Nbn T A 4: 15,964,289 D121E probably damaging Het
Nox4 A G 7: 87,370,023 Y408C probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1153 G A 2: 87,896,942 A248T probably benign Het
Olfr1491 A G 19: 13,705,202 D125G probably damaging Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Osbpl5 T C 7: 143,709,202 T150A possibly damaging Het
Pgap3 C A 11: 98,390,053 M265I probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd2l2 A T 18: 34,427,393 N351I possibly damaging Het
Prkdc T A 16: 15,675,328 Y700N probably benign Het
Pzp A G 6: 128,523,968 probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptor A T 11: 119,896,001 Q1264L probably benign Het
Scnn1a T C 6: 125,322,140 F61S probably damaging Het
Tenm2 C A 11: 36,106,783 W825C probably damaging Het
Tex264 A T 9: 106,681,917 I70N possibly damaging Het
Trpc2 T A 7: 102,084,240 F132Y probably damaging Het
Trpm4 A G 7: 45,308,597 F816S probably damaging Het
Uqcc1 G A 2: 155,921,721 Q5* probably null Het
Usp36 G T 11: 118,284,945 T130N probably damaging Het
Vav1 A G 17: 57,297,252 M165V probably benign Het
Vmn1r64 A T 7: 5,883,804 F247I probably damaging Het
Vmn2r26 G C 6: 124,039,747 R390P probably benign Het
Vmn2r57 G T 7: 41,400,124 H734N probably benign Het
Wfdc16 G T 2: 164,635,923 H69N possibly damaging Het
Zfp316 C T 5: 143,253,562 E901K probably damaging Het
Zfp334 T C 2: 165,381,799 E108G probably damaging Het
Zfp407 T C 18: 84,209,638 S1949G probably benign Het
Zfp408 A G 2: 91,646,128 L227P probably benign Het
Zfp560 T C 9: 20,347,991 H525R possibly damaging Het
Zfp609 G A 9: 65,704,472 A403V possibly damaging Het
Other mutations in Tns2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Tns2 APN 15 102113191 missense probably damaging 1.00
IGL01935:Tns2 APN 15 102111634 unclassified probably null
IGL01994:Tns2 APN 15 102111379 missense possibly damaging 0.81
IGL02025:Tns2 APN 15 102112049 nonsense probably null
IGL02135:Tns2 APN 15 102113026 missense probably damaging 1.00
IGL02355:Tns2 APN 15 102112290 missense probably benign
IGL02362:Tns2 APN 15 102112290 missense probably benign
IGL02439:Tns2 APN 15 102114543 missense probably damaging 1.00
IGL02488:Tns2 APN 15 102112743 missense probably benign
IGL02546:Tns2 APN 15 102110940 missense probably damaging 1.00
IGL02616:Tns2 APN 15 102111415 missense probably benign
IGL02628:Tns2 APN 15 102111828 missense probably benign 0.04
IGL02658:Tns2 APN 15 102107796 splice site probably benign
IGL03267:Tns2 APN 15 102105378 critical splice donor site probably null
P0005:Tns2 UTSW 15 102114056 missense probably damaging 0.98
R0586:Tns2 UTSW 15 102109585 splice site probably benign
R0791:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0817:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0818:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0819:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0820:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1451:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1452:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1453:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1454:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1455:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1487:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1510:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1698:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1772:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1779:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1843:Tns2 UTSW 15 102113133 unclassified probably null
R1923:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1924:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1927:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1980:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2051:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2087:Tns2 UTSW 15 102107119 missense possibly damaging 0.70
R2100:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2103:Tns2 UTSW 15 102112665 critical splice acceptor site probably null
R2105:Tns2 UTSW 15 102107506 missense probably benign 0.27
R2224:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2225:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2227:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2252:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2253:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2290:Tns2 UTSW 15 102112023 missense probably damaging 0.99
R2304:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2318:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2446:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2447:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2448:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2566:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2567:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2897:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2898:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3159:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3160:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3162:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3162:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3196:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3237:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3426:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3427:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3428:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3695:Tns2 UTSW 15 102112749 missense probably null
R3767:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3911:Tns2 UTSW 15 102113837 critical splice donor site probably null
R4113:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4157:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4394:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4395:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4396:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4439:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4441:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4537:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4538:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4541:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4599:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4600:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4602:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4773:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4774:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4775:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4776:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4880:Tns2 UTSW 15 102112039 missense probably damaging 0.98
R4989:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5014:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5058:Tns2 UTSW 15 102107860 missense possibly damaging 0.68
R5253:Tns2 UTSW 15 102111453 missense probably damaging 1.00
R5336:Tns2 UTSW 15 102111229 missense probably damaging 1.00
R5351:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5452:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5453:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5629:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5630:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5631:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5685:Tns2 UTSW 15 102107103 missense probably benign 0.02
R5844:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6048:Tns2 UTSW 15 102111411 missense probably damaging 1.00
R6067:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6079:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6130:Tns2 UTSW 15 102111241 missense probably damaging 1.00
R6136:Tns2 UTSW 15 102107030 missense probably damaging 1.00
R6138:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6199:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6210:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6426:Tns2 UTSW 15 102107037 missense possibly damaging 0.65
R6544:Tns2 UTSW 15 102113834 missense possibly damaging 0.93
R6594:Tns2 UTSW 15 102110559 missense probably benign 0.00
R6596:Tns2 UTSW 15 102110559 missense probably benign 0.00
R6734:Tns2 UTSW 15 102103116 missense probably damaging 0.96
U15987:Tns2 UTSW 15 102108934 missense probably damaging 1.00
X0009:Tns2 UTSW 15 102112465 missense possibly damaging 0.94
X0026:Tns2 UTSW 15 102110502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAATCAGCACCATGAGGATAGCG -3'
(R):5'- CCTGTGGCCTGAATACATCCCAAG -3'

Sequencing Primer
(F):5'- CACCATGAGGATAGCGTGGAC -3'
(R):5'- ACAGAGGGCTGCTCTTCATC -3'
Posted On2014-04-13