Incidental Mutation 'R1579:1700037C18Rik'
ID171321
Institutional Source Beutler Lab
Gene Symbol 1700037C18Rik
Ensembl Gene ENSMUSG00000005983
Gene NameRIKEN cDNA 1700037C18 gene
Synonyms
MMRRC Submission 039616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R1579 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location3895179-3908689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3906175 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 162 (R162G)
Ref Sequence ENSEMBL: ENSMUSP00000111525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006138] [ENSMUST00000006139] [ENSMUST00000040881] [ENSMUST00000115859] [ENSMUST00000115860] [ENSMUST00000123235] [ENSMUST00000124849] [ENSMUST00000139294] [ENSMUST00000143537] [ENSMUST00000145150] [ENSMUST00000150655] [ENSMUST00000175809] [ENSMUST00000176224] [ENSMUST00000176233] [ENSMUST00000176625] [ENSMUST00000177221] [ENSMUST00000177323] [ENSMUST00000186375]
Predicted Effect probably benign
Transcript: ENSMUST00000006138
SMART Domains Protein: ENSMUSP00000006138
Gene: ENSMUSG00000005982

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 50 157 4.2e-11 PFAM
Pfam:Acetyltransf_1 57 156 4.2e-15 PFAM
Pfam:FR47 77 164 8.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000006139
SMART Domains Protein: ENSMUSP00000006139
Gene: ENSMUSG00000005983

DomainStartEndE-ValueType
Pfam:DUF4644 16 139 7.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040881
SMART Domains Protein: ENSMUSP00000043397
Gene: ENSMUSG00000014232

DomainStartEndE-ValueType
Pfam:Cluap1 14 283 2.5e-121 PFAM
low complexity region 297 307 N/A INTRINSIC
low complexity region 310 330 N/A INTRINSIC
low complexity region 360 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115859
AA Change: R162G

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111525
Gene: ENSMUSG00000005983
AA Change: R162G

DomainStartEndE-ValueType
Pfam:DUF4644 2 162 4.7e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115860
SMART Domains Protein: ENSMUSP00000111526
Gene: ENSMUSG00000005982

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 50 157 4.2e-11 PFAM
Pfam:Acetyltransf_1 57 156 4.2e-15 PFAM
Pfam:FR47 77 164 8.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123235
SMART Domains Protein: ENSMUSP00000135233
Gene: ENSMUSG00000005983

DomainStartEndE-ValueType
Pfam:DUF4644 7 67 1.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124849
SMART Domains Protein: ENSMUSP00000119490
Gene: ENSMUSG00000014232

DomainStartEndE-ValueType
Pfam:Cluap1 3 206 8.7e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137745
Predicted Effect probably benign
Transcript: ENSMUST00000139294
Predicted Effect probably benign
Transcript: ENSMUST00000143537
SMART Domains Protein: ENSMUSP00000135188
Gene: ENSMUSG00000005982

DomainStartEndE-ValueType
SCOP:d1cjwa_ 10 113 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145150
SMART Domains Protein: ENSMUSP00000116855
Gene: ENSMUSG00000014232

DomainStartEndE-ValueType
Pfam:Cluap1 3 188 9.9e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146935
Predicted Effect probably benign
Transcript: ENSMUST00000150655
SMART Domains Protein: ENSMUSP00000135206
Gene: ENSMUSG00000005982

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 50 157 4.2e-11 PFAM
Pfam:Acetyltransf_1 57 156 4.2e-15 PFAM
Pfam:FR47 77 164 8.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175809
SMART Domains Protein: ENSMUSP00000135810
Gene: ENSMUSG00000005982

DomainStartEndE-ValueType
SCOP:d1qsma_ 12 67 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176224
SMART Domains Protein: ENSMUSP00000135152
Gene: ENSMUSG00000005982

DomainStartEndE-ValueType
SCOP:d1cjwa_ 10 112 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176233
SMART Domains Protein: ENSMUSP00000135826
Gene: ENSMUSG00000093575

DomainStartEndE-ValueType
Pfam:Cluap1 119 282 2.8e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176625
SMART Domains Protein: ENSMUSP00000134768
Gene: ENSMUSG00000005982

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 4 91 1.1e-13 PFAM
Pfam:Acetyltransf_7 7 92 1e-10 PFAM
Pfam:FR47 12 99 1.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177221
SMART Domains Protein: ENSMUSP00000134800
Gene: ENSMUSG00000005983

DomainStartEndE-ValueType
Pfam:DUF4644 13 144 7.2e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177323
AA Change: R166G

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135766
Gene: ENSMUSG00000005983
AA Change: R166G

DomainStartEndE-ValueType
Pfam:DUF4644 6 166 1.5e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177519
Predicted Effect probably benign
Transcript: ENSMUST00000186375
SMART Domains Protein: ENSMUSP00000140031
Gene: ENSMUSG00000005982

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 50 157 4.2e-11 PFAM
Pfam:Acetyltransf_1 57 156 4.2e-15 PFAM
Pfam:FR47 77 164 8.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195807
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 T A 3: 95,685,497 probably benign Het
Adgrv1 A T 13: 81,563,779 L306H probably damaging Het
Aknad1 T A 3: 108,752,136 Y155* probably null Het
Aldh6a1 C T 12: 84,441,848 R88H possibly damaging Het
Apc2 G C 10: 80,311,345 K715N probably damaging Het
Arhgap45 G A 10: 80,028,977 V798M probably damaging Het
BC037034 T C 5: 138,261,866 I338V probably benign Het
Calcrl T C 2: 84,333,537 T437A probably benign Het
Cdan1 A G 2: 120,730,739 F183L probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntnap4 A G 8: 112,881,830 E1294G possibly damaging Het
Crybg3 C A 16: 59,530,198 G2607V probably damaging Het
Dhx29 G T 13: 112,935,598 probably null Het
Dmrtb1 T A 4: 107,684,125 H13L probably damaging Het
Echdc2 A G 4: 108,173,809 M162V probably benign Het
Entpd8 A G 2: 25,084,974 D439G possibly damaging Het
Fastkd2 C G 1: 63,745,887 H477Q probably null Het
Fbrs A G 7: 127,485,357 E517G probably damaging Het
Gchfr A G 2: 119,172,021 T71A possibly damaging Het
Hecw1 A T 13: 14,377,907 C35S probably damaging Het
Izumo1r C T 9: 14,901,802 R58H probably benign Het
Kif13a T C 13: 46,752,856 E537G possibly damaging Het
Kif13b G A 14: 64,782,341 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lnpk A T 2: 74,547,996 D140E probably damaging Het
Ltbp1 A G 17: 75,252,367 M284V probably benign Het
Me3 A T 7: 89,845,842 T323S possibly damaging Het
Mtus1 A G 8: 41,082,858 V607A probably damaging Het
Myh14 A T 7: 44,655,694 probably null Het
Myo1h T A 5: 114,347,435 C545* probably null Het
Nbn T A 4: 15,964,289 D121E probably damaging Het
Nox4 A G 7: 87,370,023 Y408C probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1153 G A 2: 87,896,942 A248T probably benign Het
Olfr1491 A G 19: 13,705,202 D125G probably damaging Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Osbpl5 T C 7: 143,709,202 T150A possibly damaging Het
Pgap3 C A 11: 98,390,053 M265I probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd2l2 A T 18: 34,427,393 N351I possibly damaging Het
Prkdc T A 16: 15,675,328 Y700N probably benign Het
Pzp A G 6: 128,523,968 probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptor A T 11: 119,896,001 Q1264L probably benign Het
Scnn1a T C 6: 125,322,140 F61S probably damaging Het
Tenm2 C A 11: 36,106,783 W825C probably damaging Het
Tex264 A T 9: 106,681,917 I70N possibly damaging Het
Tns2 G T 15: 102,111,210 D504Y probably damaging Het
Trpc2 T A 7: 102,084,240 F132Y probably damaging Het
Trpm4 A G 7: 45,308,597 F816S probably damaging Het
Uqcc1 G A 2: 155,921,721 Q5* probably null Het
Usp36 G T 11: 118,284,945 T130N probably damaging Het
Vav1 A G 17: 57,297,252 M165V probably benign Het
Vmn1r64 A T 7: 5,883,804 F247I probably damaging Het
Vmn2r26 G C 6: 124,039,747 R390P probably benign Het
Vmn2r57 G T 7: 41,400,124 H734N probably benign Het
Wfdc16 G T 2: 164,635,923 H69N possibly damaging Het
Zfp316 C T 5: 143,253,562 E901K probably damaging Het
Zfp334 T C 2: 165,381,799 E108G probably damaging Het
Zfp407 T C 18: 84,209,638 S1949G probably benign Het
Zfp408 A G 2: 91,646,128 L227P probably benign Het
Zfp560 T C 9: 20,347,991 H525R possibly damaging Het
Zfp609 G A 9: 65,704,472 A403V possibly damaging Het
Other mutations in 1700037C18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02275:1700037C18Rik APN 16 3906282 missense probably damaging 1.00
R0485:1700037C18Rik UTSW 16 3907647 missense probably damaging 0.99
R1643:1700037C18Rik UTSW 16 3907078 nonsense probably null
R2181:1700037C18Rik UTSW 16 3907086 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGGGCATGGGCATTCCATTTCTTC -3'
(R):5'- GGACCTTGGACAACTTTGCCTCAG -3'

Sequencing Primer
(F):5'- TTTCCCCAGACTAGCCCAGG -3'
(R):5'- caactttgcctcagttccttc -3'
Posted On2014-04-13