Incidental Mutation 'R1579:Ltbp1'
ID171326
Institutional Source Beutler Lab
Gene Symbol Ltbp1
Ensembl Gene ENSMUSG00000001870
Gene Namelatent transforming growth factor beta binding protein 1
Synonymsb2b1000Clo, LTBP-1, 9430031G15Rik
MMRRC Submission 039616-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1579 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location75005568-75392512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75252367 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 284 (M284V)
Ref Sequence ENSEMBL: ENSMUSP00000116890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001927] [ENSMUST00000112514] [ENSMUST00000112516] [ENSMUST00000135447]
Predicted Effect probably benign
Transcript: ENSMUST00000001927
AA Change: M602V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001927
Gene: ENSMUSG00000001870
AA Change: M602V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 34 49 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
low complexity region 94 109 N/A INTRINSIC
low complexity region 149 158 N/A INTRINSIC
EGF 184 213 9.27e-1 SMART
EGF 394 423 2.23e-3 SMART
Pfam:TB 559 601 2.4e-9 PFAM
EGF_CA 618 658 9.39e-11 SMART
Pfam:TB 680 720 1e-18 PFAM
low complexity region 839 849 N/A INTRINSIC
EGF_CA 865 906 5.83e-7 SMART
EGF_CA 907 948 6.39e-13 SMART
EGF_CA 949 989 4.25e-9 SMART
EGF_CA 990 1029 2.44e-9 SMART
EGF_CA 1030 1070 5.87e-12 SMART
EGF_CA 1071 1111 3.61e-12 SMART
EGF_CA 1112 1152 1.57e-12 SMART
EGF_CA 1153 1193 1.75e-10 SMART
EGF_CA 1194 1235 6.74e-12 SMART
EGF_CA 1236 1277 3.22e-9 SMART
EGF 1281 1320 2.16e1 SMART
Pfam:TB 1349 1391 5.6e-17 PFAM
EGF 1418 1457 1.14e0 SMART
EGF_CA 1458 1498 2.68e-6 SMART
Pfam:TB 1526 1567 4.2e-15 PFAM
EGF 1615 1652 1e-5 SMART
EGF_CA 1653 1697 5.11e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112514
AA Change: M284V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108133
Gene: ENSMUSG00000001870
AA Change: M284V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 76 105 2.23e-3 SMART
Pfam:TB 240 283 9.5e-13 PFAM
EGF_CA 300 340 9.39e-11 SMART
Pfam:TB 361 400 3.1e-17 PFAM
low complexity region 468 478 N/A INTRINSIC
EGF_CA 494 535 5.83e-7 SMART
EGF_CA 536 577 6.39e-13 SMART
EGF_CA 578 618 4.25e-9 SMART
EGF_CA 619 658 2.44e-9 SMART
EGF_CA 659 699 5.87e-12 SMART
EGF_CA 700 740 3.61e-12 SMART
EGF_CA 741 781 1.57e-12 SMART
EGF_CA 782 822 1.75e-10 SMART
EGF_CA 823 864 6.74e-12 SMART
EGF_CA 865 906 3.22e-9 SMART
EGF 910 949 2.16e1 SMART
Pfam:TB 977 1020 4.3e-20 PFAM
EGF 1047 1086 1.14e0 SMART
EGF_CA 1087 1127 2.68e-6 SMART
Pfam:TB 1154 1196 1.3e-17 PFAM
EGF 1244 1281 1e-5 SMART
EGF_CA 1282 1326 5.11e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112516
AA Change: M284V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108135
Gene: ENSMUSG00000001870
AA Change: M284V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 76 105 2.23e-3 SMART
Pfam:TB 240 283 9.9e-13 PFAM
EGF_CA 300 340 9.39e-11 SMART
Pfam:TB 361 402 7.6e-20 PFAM
low complexity region 521 531 N/A INTRINSIC
EGF_CA 547 588 5.83e-7 SMART
EGF_CA 589 630 6.39e-13 SMART
EGF_CA 631 671 4.25e-9 SMART
EGF_CA 672 711 2.44e-9 SMART
EGF_CA 712 752 5.87e-12 SMART
EGF_CA 753 793 3.61e-12 SMART
EGF_CA 794 834 1.57e-12 SMART
EGF_CA 835 875 1.75e-10 SMART
EGF_CA 876 917 6.74e-12 SMART
EGF_CA 918 959 3.22e-9 SMART
EGF 963 1002 2.16e1 SMART
Pfam:TB 1030 1073 4.5e-20 PFAM
EGF 1100 1139 1.14e0 SMART
EGF_CA 1140 1180 2.68e-6 SMART
Pfam:TB 1207 1249 1.4e-17 PFAM
EGF 1297 1334 1e-5 SMART
EGF_CA 1335 1379 5.11e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135447
AA Change: M284V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116890
Gene: ENSMUSG00000001870
AA Change: M284V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 76 105 1.1e-5 SMART
Pfam:TB 240 283 4.3e-10 PFAM
EGF_CA 300 340 4.4e-13 SMART
Pfam:TB 361 402 3.3e-17 PFAM
low complexity region 521 531 N/A INTRINSIC
EGF_CA 547 588 2.9e-9 SMART
EGF_CA 589 630 3e-15 SMART
EGF_CA 631 671 2.1e-11 SMART
EGF_CA 672 711 1.2e-11 SMART
EGF_CA 712 752 2.8e-14 SMART
EGF_CA 753 793 1.8e-14 SMART
EGF_CA 794 834 7.5e-15 SMART
EGF_CA 835 875 8.4e-13 SMART
EGF_CA 876 917 3.2e-14 SMART
EGF_CA 918 959 1.6e-11 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of latent TGF-beta binding proteins (LTBPs). The secretion and activation of TGF-betas is regulated by their association with latency-associated proteins and with latent TGF-beta binding proteins. The product of this gene targets latent complexes of transforming growth factor beta to the extracellular matrix, where the latent cytokine is subsequently activated by several different mechanisms. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality associated with defects in the aortic arch and outflow tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T C 16: 3,906,175 R162G probably benign Het
Adamtsl4 T A 3: 95,685,497 probably benign Het
Adgrv1 A T 13: 81,563,779 L306H probably damaging Het
Aknad1 T A 3: 108,752,136 Y155* probably null Het
Aldh6a1 C T 12: 84,441,848 R88H possibly damaging Het
Apc2 G C 10: 80,311,345 K715N probably damaging Het
Arhgap45 G A 10: 80,028,977 V798M probably damaging Het
BC037034 T C 5: 138,261,866 I338V probably benign Het
Calcrl T C 2: 84,333,537 T437A probably benign Het
Cdan1 A G 2: 120,730,739 F183L probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntnap4 A G 8: 112,881,830 E1294G possibly damaging Het
Crybg3 C A 16: 59,530,198 G2607V probably damaging Het
Dhx29 G T 13: 112,935,598 probably null Het
Dmrtb1 T A 4: 107,684,125 H13L probably damaging Het
Echdc2 A G 4: 108,173,809 M162V probably benign Het
Entpd8 A G 2: 25,084,974 D439G possibly damaging Het
Fastkd2 C G 1: 63,745,887 H477Q probably null Het
Fbrs A G 7: 127,485,357 E517G probably damaging Het
Gchfr A G 2: 119,172,021 T71A possibly damaging Het
Hecw1 A T 13: 14,377,907 C35S probably damaging Het
Izumo1r C T 9: 14,901,802 R58H probably benign Het
Kif13a T C 13: 46,752,856 E537G possibly damaging Het
Kif13b G A 14: 64,782,341 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lnpk A T 2: 74,547,996 D140E probably damaging Het
Me3 A T 7: 89,845,842 T323S possibly damaging Het
Mtus1 A G 8: 41,082,858 V607A probably damaging Het
Myh14 A T 7: 44,655,694 probably null Het
Myo1h T A 5: 114,347,435 C545* probably null Het
Nbn T A 4: 15,964,289 D121E probably damaging Het
Nox4 A G 7: 87,370,023 Y408C probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1153 G A 2: 87,896,942 A248T probably benign Het
Olfr1491 A G 19: 13,705,202 D125G probably damaging Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Osbpl5 T C 7: 143,709,202 T150A possibly damaging Het
Pgap3 C A 11: 98,390,053 M265I probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd2l2 A T 18: 34,427,393 N351I possibly damaging Het
Prkdc T A 16: 15,675,328 Y700N probably benign Het
Pzp A G 6: 128,523,968 probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptor A T 11: 119,896,001 Q1264L probably benign Het
Scnn1a T C 6: 125,322,140 F61S probably damaging Het
Tenm2 C A 11: 36,106,783 W825C probably damaging Het
Tex264 A T 9: 106,681,917 I70N possibly damaging Het
Tns2 G T 15: 102,111,210 D504Y probably damaging Het
Trpc2 T A 7: 102,084,240 F132Y probably damaging Het
Trpm4 A G 7: 45,308,597 F816S probably damaging Het
Uqcc1 G A 2: 155,921,721 Q5* probably null Het
Usp36 G T 11: 118,284,945 T130N probably damaging Het
Vav1 A G 17: 57,297,252 M165V probably benign Het
Vmn1r64 A T 7: 5,883,804 F247I probably damaging Het
Vmn2r26 G C 6: 124,039,747 R390P probably benign Het
Vmn2r57 G T 7: 41,400,124 H734N probably benign Het
Wfdc16 G T 2: 164,635,923 H69N possibly damaging Het
Zfp316 C T 5: 143,253,562 E901K probably damaging Het
Zfp334 T C 2: 165,381,799 E108G probably damaging Het
Zfp407 T C 18: 84,209,638 S1949G probably benign Het
Zfp408 A G 2: 91,646,128 L227P probably benign Het
Zfp560 T C 9: 20,347,991 H525R possibly damaging Het
Zfp609 G A 9: 65,704,472 A403V possibly damaging Het
Other mutations in Ltbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ltbp1 APN 17 75225338 missense probably damaging 1.00
IGL00156:Ltbp1 APN 17 75385160 missense probably damaging 0.97
IGL00161:Ltbp1 APN 17 75310152 splice site probably benign
IGL00771:Ltbp1 APN 17 75362516 missense probably damaging 1.00
IGL00822:Ltbp1 APN 17 75151321 missense probably damaging 1.00
IGL01760:Ltbp1 APN 17 75227150 missense probably damaging 0.97
IGL01796:Ltbp1 APN 17 75227245 splice site probably benign
IGL01826:Ltbp1 APN 17 75292840 missense possibly damaging 0.67
IGL02372:Ltbp1 APN 17 75252406 missense probably damaging 0.99
IGL02792:Ltbp1 APN 17 75282994 missense probably damaging 1.00
IGL02862:Ltbp1 APN 17 75390471 missense probably damaging 1.00
IGL03095:Ltbp1 APN 17 75282418 missense possibly damaging 0.67
IGL03345:Ltbp1 APN 17 75066159 missense probably damaging 0.99
IGL03404:Ltbp1 APN 17 75225306 missense probably damaging 0.97
R0010:Ltbp1 UTSW 17 75363391 missense probably damaging 1.00
R0010:Ltbp1 UTSW 17 75363391 missense probably damaging 1.00
R0022:Ltbp1 UTSW 17 75364360 missense probably damaging 1.00
R0022:Ltbp1 UTSW 17 75364360 missense probably damaging 1.00
R0033:Ltbp1 UTSW 17 75276509 missense possibly damaging 0.66
R0033:Ltbp1 UTSW 17 75276509 missense possibly damaging 0.66
R0034:Ltbp1 UTSW 17 75047568 intron probably benign
R0068:Ltbp1 UTSW 17 75359409 missense probably damaging 1.00
R0068:Ltbp1 UTSW 17 75359409 missense probably damaging 1.00
R0467:Ltbp1 UTSW 17 75282429 critical splice donor site probably null
R0554:Ltbp1 UTSW 17 75225279 missense probably damaging 0.99
R0584:Ltbp1 UTSW 17 75363472 missense probably damaging 1.00
R0863:Ltbp1 UTSW 17 75252386 missense probably damaging 1.00
R0991:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1084:Ltbp1 UTSW 17 75359425 nonsense probably null
R1114:Ltbp1 UTSW 17 75360775 missense probably benign
R1177:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1179:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1195:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1195:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1195:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1245:Ltbp1 UTSW 17 75327194 splice site probably benign
R1246:Ltbp1 UTSW 17 75385161 nonsense probably null
R1258:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1259:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1260:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1262:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1265:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1267:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1269:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1272:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1411:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1694:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1705:Ltbp1 UTSW 17 75385201 splice site probably null
R1716:Ltbp1 UTSW 17 75315024 missense probably benign 0.08
R1815:Ltbp1 UTSW 17 75252380 missense probably benign 0.00
R1932:Ltbp1 UTSW 17 75313034 missense probably benign 0.01
R1951:Ltbp1 UTSW 17 75151377 missense probably benign 0.00
R2044:Ltbp1 UTSW 17 75276432 missense probably damaging 1.00
R2118:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2120:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2121:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2122:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2171:Ltbp1 UTSW 17 75291317 missense probably damaging 0.99
R2237:Ltbp1 UTSW 17 75310163 missense probably benign 0.31
R2655:Ltbp1 UTSW 17 75005983 missense possibly damaging 0.76
R2941:Ltbp1 UTSW 17 75179093 missense probably damaging 1.00
R3177:Ltbp1 UTSW 17 75276480 missense possibly damaging 0.65
R3177:Ltbp1 UTSW 17 75359278 splice site probably null
R3277:Ltbp1 UTSW 17 75276480 missense possibly damaging 0.65
R3277:Ltbp1 UTSW 17 75359278 splice site probably null
R3797:Ltbp1 UTSW 17 75362630 missense probably damaging 1.00
R3861:Ltbp1 UTSW 17 75359338 missense possibly damaging 0.93
R3897:Ltbp1 UTSW 17 75274016 missense probably damaging 1.00
R4002:Ltbp1 UTSW 17 75310159 missense probably benign 0.09
R4057:Ltbp1 UTSW 17 75310194 missense probably damaging 1.00
R4261:Ltbp1 UTSW 17 75291367 nonsense probably null
R4375:Ltbp1 UTSW 17 75312997 missense probably damaging 1.00
R4458:Ltbp1 UTSW 17 75276507 missense possibly damaging 0.96
R4519:Ltbp1 UTSW 17 75364497 missense probably benign 0.14
R4529:Ltbp1 UTSW 17 75151360 missense probably benign 0.21
R4614:Ltbp1 UTSW 17 75289994 intron probably benign
R4724:Ltbp1 UTSW 17 75313008 missense probably damaging 0.99
R4756:Ltbp1 UTSW 17 75225204 missense probably damaging 1.00
R4907:Ltbp1 UTSW 17 75005904 missense probably benign
R4910:Ltbp1 UTSW 17 75327292 missense probably damaging 1.00
R4976:Ltbp1 UTSW 17 75321095 critical splice donor site probably null
R5011:Ltbp1 UTSW 17 75066157 missense probably damaging 0.99
R5047:Ltbp1 UTSW 17 75292886 splice site probably benign
R5259:Ltbp1 UTSW 17 75363362 missense probably benign 0.03
R5438:Ltbp1 UTSW 17 75291326 missense probably damaging 0.98
R5583:Ltbp1 UTSW 17 75291330 missense probably benign 0.00
R5757:Ltbp1 UTSW 17 75273949 synonymous probably null
R5950:Ltbp1 UTSW 17 75273870 missense probably damaging 1.00
R5976:Ltbp1 UTSW 17 75290083 missense probably damaging 1.00
R6267:Ltbp1 UTSW 17 75005989 missense possibly damaging 0.70
R6383:Ltbp1 UTSW 17 75359457 missense probably damaging 0.99
R6400:Ltbp1 UTSW 17 75151402 missense possibly damaging 0.62
R6861:Ltbp1 UTSW 17 75227192 missense possibly damaging 0.76
R6880:Ltbp1 UTSW 17 75321049 missense possibly damaging 0.77
X0001:Ltbp1 UTSW 17 75227178 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGCAACTTCCACATGCCAATGTTTC -3'
(R):5'- TGGAGAGAGCAGGACATCACACATC -3'

Sequencing Primer
(F):5'- CAGTAAAGGTTTCCTGTCAACTTC -3'
(R):5'- CTACCATGTAACTGTCACATGCTG -3'
Posted On2014-04-13