Incidental Mutation 'R1579:Olfr1491'
ID171329
Institutional Source Beutler Lab
Gene Symbol Olfr1491
Ensembl Gene ENSMUSG00000051156
Gene Nameolfactory receptor 1491
SynonymsGA_x6K02T2RE5P-4037809-4038768, MOR266-8
MMRRC Submission 039616-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1579 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13697268-13706127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13705202 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 125 (D125G)
Ref Sequence ENSEMBL: ENSMUSP00000149884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052737] [ENSMUST00000214007] [ENSMUST00000215493] [ENSMUST00000216366] [ENSMUST00000216377] [ENSMUST00000216622]
Predicted Effect probably damaging
Transcript: ENSMUST00000052737
AA Change: D125G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057902
Gene: ENSMUSG00000051156
AA Change: D125G

DomainStartEndE-ValueType
Pfam:7tm_4 35 314 3.3e-52 PFAM
Pfam:7tm_1 45 295 5.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214007
AA Change: D125G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215493
AA Change: D125G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216366
AA Change: D125G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216377
AA Change: D125G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216622
AA Change: D125G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T C 16: 3,906,175 R162G probably benign Het
Adamtsl4 T A 3: 95,685,497 probably benign Het
Adgrv1 A T 13: 81,563,779 L306H probably damaging Het
Aknad1 T A 3: 108,752,136 Y155* probably null Het
Aldh6a1 C T 12: 84,441,848 R88H possibly damaging Het
Apc2 G C 10: 80,311,345 K715N probably damaging Het
Arhgap45 G A 10: 80,028,977 V798M probably damaging Het
BC037034 T C 5: 138,261,866 I338V probably benign Het
Calcrl T C 2: 84,333,537 T437A probably benign Het
Cdan1 A G 2: 120,730,739 F183L probably damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cntnap4 A G 8: 112,881,830 E1294G possibly damaging Het
Crybg3 C A 16: 59,530,198 G2607V probably damaging Het
Dhx29 G T 13: 112,935,598 probably null Het
Dmrtb1 T A 4: 107,684,125 H13L probably damaging Het
Echdc2 A G 4: 108,173,809 M162V probably benign Het
Entpd8 A G 2: 25,084,974 D439G possibly damaging Het
Fastkd2 C G 1: 63,745,887 H477Q probably null Het
Fbrs A G 7: 127,485,357 E517G probably damaging Het
Gchfr A G 2: 119,172,021 T71A possibly damaging Het
Hecw1 A T 13: 14,377,907 C35S probably damaging Het
Izumo1r C T 9: 14,901,802 R58H probably benign Het
Kif13a T C 13: 46,752,856 E537G possibly damaging Het
Kif13b G A 14: 64,782,341 probably null Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lnpk A T 2: 74,547,996 D140E probably damaging Het
Ltbp1 A G 17: 75,252,367 M284V probably benign Het
Me3 A T 7: 89,845,842 T323S possibly damaging Het
Mtus1 A G 8: 41,082,858 V607A probably damaging Het
Myh14 A T 7: 44,655,694 probably null Het
Myo1h T A 5: 114,347,435 C545* probably null Het
Nbn T A 4: 15,964,289 D121E probably damaging Het
Nox4 A G 7: 87,370,023 Y408C probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1153 G A 2: 87,896,942 A248T probably benign Het
Olfr653 T A 7: 104,580,061 Y138* probably null Het
Osbpl5 T C 7: 143,709,202 T150A possibly damaging Het
Pgap3 C A 11: 98,390,053 M265I probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Pkd2l2 A T 18: 34,427,393 N351I possibly damaging Het
Prkdc T A 16: 15,675,328 Y700N probably benign Het
Pzp A G 6: 128,523,968 probably null Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rptor A T 11: 119,896,001 Q1264L probably benign Het
Scnn1a T C 6: 125,322,140 F61S probably damaging Het
Tenm2 C A 11: 36,106,783 W825C probably damaging Het
Tex264 A T 9: 106,681,917 I70N possibly damaging Het
Tns2 G T 15: 102,111,210 D504Y probably damaging Het
Trpc2 T A 7: 102,084,240 F132Y probably damaging Het
Trpm4 A G 7: 45,308,597 F816S probably damaging Het
Uqcc1 G A 2: 155,921,721 Q5* probably null Het
Usp36 G T 11: 118,284,945 T130N probably damaging Het
Vav1 A G 17: 57,297,252 M165V probably benign Het
Vmn1r64 A T 7: 5,883,804 F247I probably damaging Het
Vmn2r26 G C 6: 124,039,747 R390P probably benign Het
Vmn2r57 G T 7: 41,400,124 H734N probably benign Het
Wfdc16 G T 2: 164,635,923 H69N possibly damaging Het
Zfp316 C T 5: 143,253,562 E901K probably damaging Het
Zfp334 T C 2: 165,381,799 E108G probably damaging Het
Zfp407 T C 18: 84,209,638 S1949G probably benign Het
Zfp408 A G 2: 91,646,128 L227P probably benign Het
Zfp560 T C 9: 20,347,991 H525R possibly damaging Het
Zfp609 G A 9: 65,704,472 A403V possibly damaging Het
Other mutations in Olfr1491
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Olfr1491 APN 19 13705732 missense probably benign 0.05
IGL02713:Olfr1491 APN 19 13705189 missense possibly damaging 0.78
IGL02822:Olfr1491 APN 19 13705655 missense probably benign 0.13
R0083:Olfr1491 UTSW 19 13705678 missense probably damaging 0.99
R0108:Olfr1491 UTSW 19 13705678 missense probably damaging 0.99
R0271:Olfr1491 UTSW 19 13705135 missense probably benign 0.03
R1364:Olfr1491 UTSW 19 13705445 missense probably benign 0.11
R1538:Olfr1491 UTSW 19 13705496 missense probably damaging 1.00
R1575:Olfr1491 UTSW 19 13705525 missense probably benign 0.00
R2179:Olfr1491 UTSW 19 13705394 missense probably damaging 0.98
R4393:Olfr1491 UTSW 19 13705190 missense possibly damaging 0.50
R5837:Olfr1491 UTSW 19 13704960 nonsense probably null
R6001:Olfr1491 UTSW 19 13705060 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTGTGGCAACACTGCCATCATC -3'
(R):5'- CACATGAATGTCAGCACAGGCTAGG -3'

Sequencing Primer
(F):5'- ACACCCATGTATTTCTTCCTCAGTAG -3'
(R):5'- CAGGACTGGAGGCACATCAC -3'
Posted On2014-04-13