Incidental Mutation 'R1580:Abca12'
ID171332
Institutional Source Beutler Lab
Gene Symbol Abca12
Ensembl Gene ENSMUSG00000050296
Gene NameATP-binding cassette, sub-family A (ABC1), member 12
Synonyms4833417A11Rik, 4832428G11Rik
MMRRC Submission 039617-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1580 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location71242276-71414910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 71265965 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 2044 (V2044I)
Ref Sequence ENSEMBL: ENSMUSP00000084523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087268]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087268
AA Change: V2044I

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084523
Gene: ENSMUSG00000050296
AA Change: V2044I

DomainStartEndE-ValueType
transmembrane domain 24 43 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
Pfam:ABC2_membrane_3 885 1267 2.9e-24 PFAM
AAA 1370 1554 4.2e-10 SMART
low complexity region 1717 1735 N/A INTRINSIC
Pfam:ABC2_membrane_3 1744 2206 9.6e-35 PFAM
AAA 2282 2467 4.61e-7 SMART
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily, which is the only major ABC subfamily found exclusively in multicellular eukaryotes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with defective skin development and abnormal lung morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp2c2 A G 8: 119,752,987 N752D probably benign Het
Atp6v0a1 T C 11: 101,029,204 I221T probably damaging Het
Atp8b5 T C 4: 43,355,673 V551A possibly damaging Het
B3galnt1 A G 3: 69,575,707 S74P possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Brms1l A T 12: 55,868,222 K305N probably damaging Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Chst9 T G 18: 15,453,065 K147T probably benign Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Clec5a G T 6: 40,585,219 H4N probably benign Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp2a4 T C 7: 26,307,651 I61T possibly damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Dok2 A G 14: 70,776,957 D195G probably benign Het
Emilin1 A G 5: 30,917,420 E335G probably damaging Het
Fam205c T C 4: 42,874,020 probably null Het
Gm7361 G T 5: 26,257,770 L3F probably damaging Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Lins1 C A 7: 66,714,491 D711E probably benign Het
Mbtps1 C T 8: 119,538,900 V303I possibly damaging Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr299 A G 7: 86,465,450 E13G probably benign Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Vmn2r45 T G 7: 8,471,747 S761R possibly damaging Het
Zfp580 C T 7: 5,053,285 R215C probably damaging Het
Zfpm2 A G 15: 41,103,209 D898G possibly damaging Het
Other mutations in Abca12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca12 APN 1 71303541 missense possibly damaging 0.64
IGL00556:Abca12 APN 1 71353757 missense probably benign 0.00
IGL00813:Abca12 APN 1 71353762 critical splice acceptor site probably null
IGL00835:Abca12 APN 1 71302733 missense probably damaging 1.00
IGL00921:Abca12 APN 1 71285729 missense probably damaging 1.00
IGL01011:Abca12 APN 1 71263632 missense probably benign 0.02
IGL01066:Abca12 APN 1 71353730 missense possibly damaging 0.95
IGL01082:Abca12 APN 1 71314114 missense probably damaging 1.00
IGL01310:Abca12 APN 1 71284156 missense probably benign 0.00
IGL01360:Abca12 APN 1 71286489 missense possibly damaging 0.95
IGL01585:Abca12 APN 1 71319886 missense probably benign 0.00
IGL01608:Abca12 APN 1 71259442 missense probably damaging 1.00
IGL01687:Abca12 APN 1 71267610 splice site probably benign
IGL01700:Abca12 APN 1 71280390 missense probably benign
IGL01723:Abca12 APN 1 71314168 missense probably benign 0.01
IGL01804:Abca12 APN 1 71276183 missense probably benign 0.01
IGL01982:Abca12 APN 1 71346698 missense probably benign 0.34
IGL02136:Abca12 APN 1 71247142 missense probably damaging 1.00
IGL02172:Abca12 APN 1 71302658 missense probably benign 0.09
IGL02222:Abca12 APN 1 71282886 missense probably benign 0.40
IGL02266:Abca12 APN 1 71268201 nonsense probably null
IGL02449:Abca12 APN 1 71401749 splice site probably null
IGL02471:Abca12 APN 1 71258198 missense probably benign 0.00
IGL02496:Abca12 APN 1 71288553 missense possibly damaging 0.55
IGL02552:Abca12 APN 1 71294747 missense probably damaging 0.96
IGL02795:Abca12 APN 1 71288748 missense probably damaging 1.00
IGL03000:Abca12 APN 1 71321800 missense probably benign 0.01
IGL03031:Abca12 APN 1 71314024 missense probably benign 0.00
IGL03131:Abca12 APN 1 71346702 missense probably benign
IGL03260:Abca12 APN 1 71284099 missense probably damaging 1.00
IGL03324:Abca12 APN 1 71314008 missense probably benign
IGL03408:Abca12 APN 1 71264795 missense probably damaging 1.00
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0121:Abca12 UTSW 1 71259786 splice site probably null
R0172:Abca12 UTSW 1 71279402 missense probably damaging 0.99
R0196:Abca12 UTSW 1 71259813 missense possibly damaging 0.81
R0400:Abca12 UTSW 1 71259776 splice site probably benign
R0466:Abca12 UTSW 1 71302663 missense probably damaging 1.00
R0616:Abca12 UTSW 1 71302671 missense probably damaging 1.00
R0668:Abca12 UTSW 1 71263614 missense probably damaging 1.00
R0928:Abca12 UTSW 1 71349174 missense probably benign 0.06
R1036:Abca12 UTSW 1 71263410 critical splice donor site probably null
R1086:Abca12 UTSW 1 71295061 splice site probably benign
R1300:Abca12 UTSW 1 71244808 missense probably damaging 1.00
R1337:Abca12 UTSW 1 71294819 missense probably benign 0.03
R1356:Abca12 UTSW 1 71302953 splice site probably benign
R1372:Abca12 UTSW 1 71294857 missense probably damaging 1.00
R1434:Abca12 UTSW 1 71309800 missense probably benign 0.00
R1675:Abca12 UTSW 1 71263411 critical splice donor site probably null
R1773:Abca12 UTSW 1 71288596 missense probably damaging 1.00
R1829:Abca12 UTSW 1 71295029 missense probably benign 0.26
R1922:Abca12 UTSW 1 71319924 missense probably benign 0.10
R1927:Abca12 UTSW 1 71244840 missense probably damaging 1.00
R2115:Abca12 UTSW 1 71244771 missense probably benign 0.01
R2146:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2148:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2149:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2150:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2299:Abca12 UTSW 1 71258222 missense probably damaging 1.00
R2392:Abca12 UTSW 1 71258105 missense probably damaging 1.00
R2571:Abca12 UTSW 1 71249885 missense probably benign 0.00
R3077:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3078:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3705:Abca12 UTSW 1 71285705 missense probably damaging 1.00
R3800:Abca12 UTSW 1 71265887 missense probably damaging 1.00
R3905:Abca12 UTSW 1 71268230 missense possibly damaging 0.79
R3905:Abca12 UTSW 1 71279457 missense probably benign 0.02
R3962:Abca12 UTSW 1 71274515 splice site probably null
R4082:Abca12 UTSW 1 71267463 missense possibly damaging 0.64
R4131:Abca12 UTSW 1 71319871 critical splice donor site probably null
R4214:Abca12 UTSW 1 71288697 missense probably damaging 0.99
R4403:Abca12 UTSW 1 71267436 missense probably damaging 1.00
R4524:Abca12 UTSW 1 71302917 missense probably benign 0.19
R4615:Abca12 UTSW 1 71330334 missense probably benign
R4617:Abca12 UTSW 1 71330334 missense probably benign
R4714:Abca12 UTSW 1 71321450 missense probably benign 0.00
R4809:Abca12 UTSW 1 71278856 missense probably benign 0.10
R4810:Abca12 UTSW 1 71303612 missense probably benign 0.00
R4825:Abca12 UTSW 1 71302685 missense possibly damaging 0.70
R4990:Abca12 UTSW 1 71294939 missense possibly damaging 0.61
R5013:Abca12 UTSW 1 71264767 missense probably damaging 0.99
R5026:Abca12 UTSW 1 71317224 missense probably benign 0.04
R5064:Abca12 UTSW 1 71300960 missense probably damaging 1.00
R5188:Abca12 UTSW 1 71291492 missense probably benign 0.23
R5234:Abca12 UTSW 1 71263664 missense probably damaging 0.99
R5267:Abca12 UTSW 1 71335774 splice site probably benign
R5302:Abca12 UTSW 1 71283952 missense possibly damaging 0.91
R5441:Abca12 UTSW 1 71295056 missense probably damaging 1.00
R5451:Abca12 UTSW 1 71294917 missense possibly damaging 0.94
R5526:Abca12 UTSW 1 71292446 missense probably benign 0.29
R5529:Abca12 UTSW 1 71264881 missense probably damaging 1.00
R5615:Abca12 UTSW 1 71307059 missense probably damaging 1.00
R5649:Abca12 UTSW 1 71291342 missense probably damaging 1.00
R5800:Abca12 UTSW 1 71321432 missense possibly damaging 0.78
R5807:Abca12 UTSW 1 71303492 missense probably damaging 1.00
R5878:Abca12 UTSW 1 71346633 missense possibly damaging 0.79
R5987:Abca12 UTSW 1 71258098 missense probably damaging 1.00
R6280:Abca12 UTSW 1 71272460 missense probably benign 0.04
R6316:Abca12 UTSW 1 71313959 missense probably benign 0.01
R6337:Abca12 UTSW 1 71295013 missense probably damaging 1.00
R6383:Abca12 UTSW 1 71247184 missense probably benign 0.03
R6564:Abca12 UTSW 1 71309850 missense possibly damaging 0.57
R6582:Abca12 UTSW 1 71258225 missense probably benign 0.00
R6756:Abca12 UTSW 1 71259353 splice site probably null
R6876:Abca12 UTSW 1 71263508 missense probably damaging 0.98
X0013:Abca12 UTSW 1 71248433 missense probably damaging 0.99
X0018:Abca12 UTSW 1 71314510 missense probably benign
X0063:Abca12 UTSW 1 71349064 missense probably benign 0.15
X0065:Abca12 UTSW 1 71341461 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GATACCCAGTAAGTGCCTGTTCGTG -3'
(R):5'- TGAGAACTGTTGCCCTGATGCTTTG -3'

Sequencing Primer
(F):5'- GTGCCTGTTCGTGATAACAAC -3'
(R):5'- GATGCTTTGCACGAAATGCC -3'
Posted On2014-04-13