Incidental Mutation 'R1580:B3galnt1'
ID171336
Institutional Source Beutler Lab
Gene Symbol B3galnt1
Ensembl Gene ENSMUSG00000043300
Gene NameUDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1
SynonymsBrainiac 1, B3galt3, Globoside blood group, Mbrn 1
MMRRC Submission 039617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R1580 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location69574158-69598960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69575707 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 74 (S74P)
Ref Sequence ENSEMBL: ENSMUSP00000058363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061826]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061826
AA Change: S74P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058363
Gene: ENSMUSG00000043300
AA Change: S74P

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Galactosyl_T 92 285 4.5e-68 PFAM
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). The encoded protein of this gene does not use N-acetylglucosamine as an acceptor sugar at all. [provided by RefSeq, Mar 2017]
PHENOTYPE: A homozygous null mutation of this gene results in embryonic lethality. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,965 V2044I possibly damaging Het
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp2c2 A G 8: 119,752,987 N752D probably benign Het
Atp6v0a1 T C 11: 101,029,204 I221T probably damaging Het
Atp8b5 T C 4: 43,355,673 V551A possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Brms1l A T 12: 55,868,222 K305N probably damaging Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Chst9 T G 18: 15,453,065 K147T probably benign Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Clec5a G T 6: 40,585,219 H4N probably benign Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp2a4 T C 7: 26,307,651 I61T possibly damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Dok2 A G 14: 70,776,957 D195G probably benign Het
Emilin1 A G 5: 30,917,420 E335G probably damaging Het
Fam205c T C 4: 42,874,020 probably null Het
Gm7361 G T 5: 26,257,770 L3F probably damaging Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Lins1 C A 7: 66,714,491 D711E probably benign Het
Mbtps1 C T 8: 119,538,900 V303I possibly damaging Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr299 A G 7: 86,465,450 E13G probably benign Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Vmn2r45 T G 7: 8,471,747 S761R possibly damaging Het
Zfp580 C T 7: 5,053,285 R215C probably damaging Het
Zfpm2 A G 15: 41,103,209 D898G possibly damaging Het
Other mutations in B3galnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0101:B3galnt1 UTSW 3 69575806 missense probably benign 0.01
R0230:B3galnt1 UTSW 3 69575340 missense possibly damaging 0.80
R1628:B3galnt1 UTSW 3 69575628 missense probably damaging 1.00
R1942:B3galnt1 UTSW 3 69575925 start codon destroyed probably null 0.90
R5137:B3galnt1 UTSW 3 69574949 missense probably benign 0.01
R6418:B3galnt1 UTSW 3 69574993 missense probably damaging 1.00
R6468:B3galnt1 UTSW 3 69575533 missense probably damaging 1.00
R6473:B3galnt1 UTSW 3 69575340 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCATCCTCCAAGGACAGGGCTAAC -3'
(R):5'- CCTGTAGAACCTGTGCCTTCTGAAC -3'

Sequencing Primer
(F):5'- ACAGGGCTAACGTTTTGTCTTC -3'
(R):5'- GGATGTCACTGAGATCCCTCAAG -3'
Posted On2014-04-13