Incidental Mutation 'R1580:Atp8b5'
ID171339
Institutional Source Beutler Lab
Gene Symbol Atp8b5
Ensembl Gene ENSMUSG00000028457
Gene NameATPase, class I, type 8B, member 5
Synonyms4930417M19Rik, FetA
MMRRC Submission 039617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1580 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43267159-43373833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43355673 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 551 (V551A)
Ref Sequence ENSEMBL: ENSMUSP00000103575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107937] [ENSMUST00000107942]
Predicted Effect probably benign
Transcript: ENSMUST00000107937
Predicted Effect possibly damaging
Transcript: ENSMUST00000107942
AA Change: V551A

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103575
Gene: ENSMUSG00000028457
AA Change: V551A

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 104 1.8e-26 PFAM
Pfam:E1-E2_ATPase 103 375 4.9e-9 PFAM
Pfam:HAD 413 847 2e-18 PFAM
Pfam:Cation_ATPase 495 594 1e-9 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2.6e-77 PFAM
low complexity region 1171 1180 N/A INTRINSIC
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,965 V2044I possibly damaging Het
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp2c2 A G 8: 119,752,987 N752D probably benign Het
Atp6v0a1 T C 11: 101,029,204 I221T probably damaging Het
B3galnt1 A G 3: 69,575,707 S74P possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Brms1l A T 12: 55,868,222 K305N probably damaging Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Chst9 T G 18: 15,453,065 K147T probably benign Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Clec5a G T 6: 40,585,219 H4N probably benign Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp2a4 T C 7: 26,307,651 I61T possibly damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Dok2 A G 14: 70,776,957 D195G probably benign Het
Emilin1 A G 5: 30,917,420 E335G probably damaging Het
Fam205c T C 4: 42,874,020 probably null Het
Gm7361 G T 5: 26,257,770 L3F probably damaging Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Lins1 C A 7: 66,714,491 D711E probably benign Het
Mbtps1 C T 8: 119,538,900 V303I possibly damaging Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr299 A G 7: 86,465,450 E13G probably benign Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Vmn2r45 T G 7: 8,471,747 S761R possibly damaging Het
Zfp580 C T 7: 5,053,285 R215C probably damaging Het
Zfpm2 A G 15: 41,103,209 D898G possibly damaging Het
Other mutations in Atp8b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Atp8b5 APN 4 43355567 missense probably damaging 1.00
IGL00970:Atp8b5 APN 4 43311938 missense probably benign 0.01
IGL01335:Atp8b5 APN 4 43302628 missense possibly damaging 0.90
IGL01462:Atp8b5 APN 4 43368010 missense possibly damaging 0.90
IGL01657:Atp8b5 APN 4 43291693 missense probably benign 0.04
IGL01935:Atp8b5 APN 4 43366638 missense probably benign 0.03
IGL01977:Atp8b5 APN 4 43320590 critical splice acceptor site probably null
IGL02102:Atp8b5 APN 4 43364167 missense probably benign 0.10
IGL02369:Atp8b5 APN 4 43334205 missense probably benign
IGL02456:Atp8b5 APN 4 43365578 missense probably benign 0.16
IGL02696:Atp8b5 APN 4 43369634 missense possibly damaging 0.61
IGL02826:Atp8b5 APN 4 43366770 missense probably damaging 1.00
IGL02947:Atp8b5 APN 4 43305774 missense possibly damaging 0.49
R0128:Atp8b5 UTSW 4 43369715 critical splice donor site probably null
R0130:Atp8b5 UTSW 4 43369715 critical splice donor site probably null
R0243:Atp8b5 UTSW 4 43366057 missense probably benign
R0256:Atp8b5 UTSW 4 43302576 intron probably benign
R0379:Atp8b5 UTSW 4 43361898 missense probably damaging 0.99
R0671:Atp8b5 UTSW 4 43291672 missense possibly damaging 0.83
R1109:Atp8b5 UTSW 4 43305719 intron probably benign
R1442:Atp8b5 UTSW 4 43334313 missense probably damaging 0.99
R1454:Atp8b5 UTSW 4 43302590 missense probably benign
R1469:Atp8b5 UTSW 4 43291733 critical splice donor site probably null
R1469:Atp8b5 UTSW 4 43291733 critical splice donor site probably null
R1503:Atp8b5 UTSW 4 43344430 missense probably damaging 1.00
R1677:Atp8b5 UTSW 4 43372903 missense possibly damaging 0.61
R1861:Atp8b5 UTSW 4 43372906 missense probably damaging 1.00
R1899:Atp8b5 UTSW 4 43361804 missense possibly damaging 0.47
R1903:Atp8b5 UTSW 4 43357063 missense probably damaging 0.98
R1961:Atp8b5 UTSW 4 43369688 missense probably damaging 0.98
R2131:Atp8b5 UTSW 4 43370726 missense probably benign 0.33
R2971:Atp8b5 UTSW 4 43361953 splice site probably benign
R3023:Atp8b5 UTSW 4 43311957 missense possibly damaging 0.82
R3433:Atp8b5 UTSW 4 43372697 missense probably benign
R3690:Atp8b5 UTSW 4 43368055 missense probably damaging 1.00
R4157:Atp8b5 UTSW 4 43365591 missense probably damaging 0.97
R4484:Atp8b5 UTSW 4 43357016 missense probably damaging 1.00
R4510:Atp8b5 UTSW 4 43320629 missense probably damaging 1.00
R4511:Atp8b5 UTSW 4 43320629 missense probably damaging 1.00
R4679:Atp8b5 UTSW 4 43365955 missense probably benign 0.16
R4753:Atp8b5 UTSW 4 43372710 missense probably damaging 1.00
R4761:Atp8b5 UTSW 4 43308504 makesense probably null
R4784:Atp8b5 UTSW 4 43356980 missense probably damaging 0.97
R4785:Atp8b5 UTSW 4 43356980 missense probably damaging 0.97
R4855:Atp8b5 UTSW 4 43344449 missense probably benign
R5422:Atp8b5 UTSW 4 43366644 missense probably benign 0.10
R5915:Atp8b5 UTSW 4 43370577 missense probably damaging 1.00
R6228:Atp8b5 UTSW 4 43304674 missense probably damaging 1.00
R6496:Atp8b5 UTSW 4 43371003 missense probably benign 0.03
R6708:Atp8b5 UTSW 4 43334249 missense probably benign
R6931:Atp8b5 UTSW 4 43364108 critical splice acceptor site probably null
R7021:Atp8b5 UTSW 4 43355618 missense probably damaging 0.99
R7085:Atp8b5 UTSW 4 43361835 missense probably damaging 1.00
R7207:Atp8b5 UTSW 4 43357018 missense probably damaging 0.97
R7404:Atp8b5 UTSW 4 43342640 missense probably benign 0.10
R7448:Atp8b5 UTSW 4 43366021 missense probably benign
R7465:Atp8b5 UTSW 4 43271269 missense probably benign 0.00
R7526:Atp8b5 UTSW 4 43366609 missense not run
X0025:Atp8b5 UTSW 4 43366774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTTGTGTCAGCCACTGGAAAC -3'
(R):5'- GGACATAGCACTTGCAGTAATCCCC -3'

Sequencing Primer
(F):5'- CAGCCACTGGAAACATGGTTTTAC -3'
(R):5'- ATCCCCTATTTATGCACAGGAG -3'
Posted On2014-04-13