Incidental Mutation 'R1580:Emilin1'
ID171341
Institutional Source Beutler Lab
Gene Symbol Emilin1
Ensembl Gene ENSMUSG00000029163
Gene Nameelastin microfibril interfacer 1
Synonyms5830419M17Rik, gp115, EMILIN-1
MMRRC Submission 039617-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R1580 (G1)
Quality Score159
Status Validated
Chromosome5
Chromosomal Location30913402-30921277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30917420 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 335 (E335G)
Ref Sequence ENSEMBL: ENSMUSP00000031055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031053] [ENSMUST00000031055] [ENSMUST00000201571] [ENSMUST00000201621] [ENSMUST00000202752]
Predicted Effect probably benign
Transcript: ENSMUST00000031053
SMART Domains Protein: ENSMUSP00000031053
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 293 5.7e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000031055
AA Change: E335G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031055
Gene: ENSMUSG00000029163
AA Change: E335G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMI 57 128 1.2e-19 PFAM
low complexity region 141 155 N/A INTRINSIC
low complexity region 157 171 N/A INTRINSIC
coiled coil region 174 210 N/A INTRINSIC
coiled coil region 237 263 N/A INTRINSIC
coiled coil region 310 342 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
internal_repeat_1 422 474 9.62e-7 PROSPERO
coiled coil region 527 563 N/A INTRINSIC
low complexity region 606 627 N/A INTRINSIC
low complexity region 629 639 N/A INTRINSIC
internal_repeat_1 704 758 9.62e-7 PROSPERO
low complexity region 780 810 N/A INTRINSIC
Pfam:Collagen 813 870 3.3e-10 PFAM
Pfam:C1q 873 1008 1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201169
Predicted Effect probably benign
Transcript: ENSMUST00000201571
SMART Domains Protein: ENSMUSP00000144226
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 70 2.4e-5 PFAM
Pfam:PfkB 65 249 4.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201621
SMART Domains Protein: ENSMUSP00000144050
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 294 1.5e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202368
Predicted Effect probably benign
Transcript: ENSMUST00000202752
SMART Domains Protein: ENSMUSP00000143850
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 243 5.8e-18 PFAM
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix glycoprotein that is characterized by an N-terminal microfibril interface domain, a coiled-coiled alpha-helical domain, a collagenous domain and a C-terminal globular C1q domain. The encoded protein associates with elastic fibers at the interface between elastin and microfibrils and may play a role in the development of elastic tissues including large blood vessels, dermis, heart and lung. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display no goss abnormalities. However, histological defects occur in the skin and aorta relating to elastin fiber abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,965 V2044I possibly damaging Het
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp2c2 A G 8: 119,752,987 N752D probably benign Het
Atp6v0a1 T C 11: 101,029,204 I221T probably damaging Het
Atp8b5 T C 4: 43,355,673 V551A possibly damaging Het
B3galnt1 A G 3: 69,575,707 S74P possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Brms1l A T 12: 55,868,222 K305N probably damaging Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Chst9 T G 18: 15,453,065 K147T probably benign Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Clec5a G T 6: 40,585,219 H4N probably benign Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp2a4 T C 7: 26,307,651 I61T possibly damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Dok2 A G 14: 70,776,957 D195G probably benign Het
Fam205c T C 4: 42,874,020 probably null Het
Gm7361 G T 5: 26,257,770 L3F probably damaging Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Lins1 C A 7: 66,714,491 D711E probably benign Het
Mbtps1 C T 8: 119,538,900 V303I possibly damaging Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr299 A G 7: 86,465,450 E13G probably benign Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Vmn2r45 T G 7: 8,471,747 S761R possibly damaging Het
Zfp580 C T 7: 5,053,285 R215C probably damaging Het
Zfpm2 A G 15: 41,103,209 D898G possibly damaging Het
Other mutations in Emilin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Emilin1 APN 5 30913902 missense probably damaging 0.97
IGL01100:Emilin1 APN 5 30918404 missense probably benign
IGL02150:Emilin1 APN 5 30920173 missense possibly damaging 0.85
IGL02416:Emilin1 APN 5 30917788 missense possibly damaging 0.92
IGL02973:Emilin1 APN 5 30920663 missense probably damaging 0.97
R0142:Emilin1 UTSW 5 30913920 missense probably benign 0.00
R0419:Emilin1 UTSW 5 30915022 missense probably damaging 1.00
R1679:Emilin1 UTSW 5 30920199 missense probably benign 0.00
R1802:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R1803:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R1864:Emilin1 UTSW 5 30918590 missense probably damaging 1.00
R1958:Emilin1 UTSW 5 30917816 missense probably benign 0.03
R2061:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2100:Emilin1 UTSW 5 30917897 missense probably benign 0.01
R2201:Emilin1 UTSW 5 30915692 missense probably benign 0.33
R2206:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2274:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2275:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2285:Emilin1 UTSW 5 30918200 missense probably damaging 1.00
R2851:Emilin1 UTSW 5 30917165 missense probably benign 0.38
R3706:Emilin1 UTSW 5 30917822 missense possibly damaging 0.47
R4205:Emilin1 UTSW 5 30919899 unclassified probably benign
R4865:Emilin1 UTSW 5 30917784 missense possibly damaging 0.93
R4878:Emilin1 UTSW 5 30917066 missense probably benign
R4981:Emilin1 UTSW 5 30919351 missense probably benign
R5113:Emilin1 UTSW 5 30920620 missense possibly damaging 0.73
R5232:Emilin1 UTSW 5 30916979 missense probably benign 0.00
R5853:Emilin1 UTSW 5 30918622 missense probably damaging 0.98
R6358:Emilin1 UTSW 5 30918218 missense probably damaging 0.98
R6807:Emilin1 UTSW 5 30915527 missense probably benign 0.10
R6932:Emilin1 UTSW 5 30917077 missense probably damaging 1.00
R6955:Emilin1 UTSW 5 30917909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCATGAAACCCTCAGTGAGATCC -3'
(R):5'- TCAGAACCTCTGCGTCCACTTAGC -3'

Sequencing Primer
(F):5'- CCATCATAATGGAGGCCCTG -3'
(R):5'- ACTTAGCACTGTCAGTGAGC -3'
Posted On2014-04-13