Incidental Mutation 'R1580:Zfp580'
ID171349
Institutional Source Beutler Lab
Gene Symbol Zfp580
Ensembl Gene ENSMUSG00000055633
Gene Namezinc finger protein 580
Synonyms
MMRRC Submission 039617-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R1580 (G1)
Quality Score138
Status Validated
Chromosome7
Chromosomal Location5051538-5053723 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5053285 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 215 (R215C)
Ref Sequence ENSEMBL: ENSMUSP00000147223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045543] [ENSMUST00000069324] [ENSMUST00000108571] [ENSMUST00000207215] [ENSMUST00000207974] [ENSMUST00000208042] [ENSMUST00000208161] [ENSMUST00000208570] [ENSMUST00000208728]
Predicted Effect probably benign
Transcript: ENSMUST00000045543
SMART Domains Protein: ENSMUSP00000041033
Gene: ENSMUSG00000035228

DomainStartEndE-ValueType
coiled coil region 62 101 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069324
AA Change: R157C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000065861
Gene: ENSMUSG00000055633
AA Change: R157C

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
ZnF_C2H2 92 114 3.39e-3 SMART
ZnF_C2H2 120 142 1.18e-2 SMART
ZnF_C2H2 150 172 1.04e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108571
SMART Domains Protein: ENSMUSP00000104211
Gene: ENSMUSG00000035228

DomainStartEndE-ValueType
Pfam:CCDC106 117 337 1.4e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145534
Predicted Effect probably benign
Transcript: ENSMUST00000207215
Predicted Effect probably benign
Transcript: ENSMUST00000207974
Predicted Effect probably benign
Transcript: ENSMUST00000208042
Predicted Effect probably benign
Transcript: ENSMUST00000208161
Predicted Effect probably damaging
Transcript: ENSMUST00000208570
AA Change: R215C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208606
Predicted Effect probably benign
Transcript: ENSMUST00000208728
Meta Mutation Damage Score 0.514 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,965 V2044I possibly damaging Het
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp2c2 A G 8: 119,752,987 N752D probably benign Het
Atp6v0a1 T C 11: 101,029,204 I221T probably damaging Het
Atp8b5 T C 4: 43,355,673 V551A possibly damaging Het
B3galnt1 A G 3: 69,575,707 S74P possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Brms1l A T 12: 55,868,222 K305N probably damaging Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Chst9 T G 18: 15,453,065 K147T probably benign Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Clec5a G T 6: 40,585,219 H4N probably benign Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp2a4 T C 7: 26,307,651 I61T possibly damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Dok2 A G 14: 70,776,957 D195G probably benign Het
Emilin1 A G 5: 30,917,420 E335G probably damaging Het
Fam205c T C 4: 42,874,020 probably null Het
Gm7361 G T 5: 26,257,770 L3F probably damaging Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Lins1 C A 7: 66,714,491 D711E probably benign Het
Mbtps1 C T 8: 119,538,900 V303I possibly damaging Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr299 A G 7: 86,465,450 E13G probably benign Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Vmn2r45 T G 7: 8,471,747 S761R possibly damaging Het
Zfpm2 A G 15: 41,103,209 D898G possibly damaging Het
Other mutations in Zfp580
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Zfp580 APN 7 5053268 missense possibly damaging 0.64
R2120:Zfp580 UTSW 7 5053009 missense probably damaging 0.99
R2167:Zfp580 UTSW 7 5053064 missense possibly damaging 0.79
R5793:Zfp580 UTSW 7 5052892 intron probably benign
Predicted Primers PCR Primer
(F):5'- CATCTGCTCATCGACGCCAACG -3'
(R):5'- TCTACATCACACAGCTAGACGGGAG -3'

Sequencing Primer
(F):5'- TACACGTACACGGTGCAG -3'
(R):5'- AGCTAGACGGGAGAAAATATAAAATG -3'
Posted On2014-04-13