Incidental Mutation 'R1580:Vmn2r45'
ID171350
Institutional Source Beutler Lab
Gene Symbol Vmn2r45
Ensembl Gene ENSMUSG00000090662
Gene Namevomeronasal 2, receptor 45
Synonyms
MMRRC Submission 039617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R1580 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location8470525-8489075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 8471747 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 761 (S761R)
Ref Sequence ENSEMBL: ENSMUSP00000129466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164845]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164845
AA Change: S761R

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129466
Gene: ENSMUSG00000090662
AA Change: S761R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 154 469 4.5e-26 PFAM
Pfam:NCD3G 512 565 6.4e-21 PFAM
Pfam:7tm_3 598 833 2.1e-54 PFAM
Meta Mutation Damage Score 0.0556 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,965 V2044I possibly damaging Het
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp2c2 A G 8: 119,752,987 N752D probably benign Het
Atp6v0a1 T C 11: 101,029,204 I221T probably damaging Het
Atp8b5 T C 4: 43,355,673 V551A possibly damaging Het
B3galnt1 A G 3: 69,575,707 S74P possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Brms1l A T 12: 55,868,222 K305N probably damaging Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Chst9 T G 18: 15,453,065 K147T probably benign Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Clec5a G T 6: 40,585,219 H4N probably benign Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp2a4 T C 7: 26,307,651 I61T possibly damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Dok2 A G 14: 70,776,957 D195G probably benign Het
Emilin1 A G 5: 30,917,420 E335G probably damaging Het
Fam205c T C 4: 42,874,020 probably null Het
Gm7361 G T 5: 26,257,770 L3F probably damaging Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Lins1 C A 7: 66,714,491 D711E probably benign Het
Mbtps1 C T 8: 119,538,900 V303I possibly damaging Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr299 A G 7: 86,465,450 E13G probably benign Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Zfp580 C T 7: 5,053,285 R215C probably damaging Het
Zfpm2 A G 15: 41,103,209 D898G possibly damaging Het
Other mutations in Vmn2r45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Vmn2r45 APN 7 8485623 missense probably benign 0.00
IGL01322:Vmn2r45 APN 7 8481333 missense possibly damaging 0.49
IGL01402:Vmn2r45 APN 7 8481468 missense probably damaging 0.98
IGL01404:Vmn2r45 APN 7 8481468 missense probably damaging 0.98
IGL01529:Vmn2r45 APN 7 8483494 missense probably benign
IGL01596:Vmn2r45 APN 7 8483273 missense probably damaging 0.98
IGL01646:Vmn2r45 APN 7 8483338 missense probably benign 0.18
IGL01819:Vmn2r45 APN 7 8485557 missense probably benign 0.00
IGL02096:Vmn2r45 APN 7 8481444 missense probably damaging 0.99
IGL02130:Vmn2r45 APN 7 8483557 missense possibly damaging 0.46
IGL02409:Vmn2r45 APN 7 8485728 missense probably benign 0.03
IGL02517:Vmn2r45 APN 7 8483186 nonsense probably null
IGL02633:Vmn2r45 APN 7 8485729 missense probably benign 0.01
IGL02940:Vmn2r45 APN 7 8472370 missense probably damaging 0.99
IGL03281:Vmn2r45 APN 7 8483604 missense probably damaging 1.00
IGL03358:Vmn2r45 APN 7 8471716 missense probably damaging 1.00
R0382:Vmn2r45 UTSW 7 8483099 missense probably benign 0.06
R0532:Vmn2r45 UTSW 7 8471821 missense probably damaging 0.99
R0932:Vmn2r45 UTSW 7 8475381 missense probably damaging 1.00
R1125:Vmn2r45 UTSW 7 8485543 missense probably benign 0.00
R1817:Vmn2r45 UTSW 7 8472373 missense probably damaging 1.00
R1996:Vmn2r45 UTSW 7 8472025 missense probably damaging 1.00
R2050:Vmn2r45 UTSW 7 8472022 missense probably damaging 1.00
R2284:Vmn2r45 UTSW 7 8485766 missense probably benign 0.02
R4019:Vmn2r45 UTSW 7 8471581 nonsense probably null
R4227:Vmn2r45 UTSW 7 8483278 missense probably damaging 0.98
R4381:Vmn2r45 UTSW 7 8471913 nonsense probably null
R4618:Vmn2r45 UTSW 7 8483437 missense probably benign 0.00
R4624:Vmn2r45 UTSW 7 8481342 missense probably damaging 1.00
R4704:Vmn2r45 UTSW 7 8483536 nonsense probably null
R4735:Vmn2r45 UTSW 7 8483473 missense probably damaging 1.00
R4868:Vmn2r45 UTSW 7 8481481 missense probably benign 0.06
R4983:Vmn2r45 UTSW 7 8483117 missense probably damaging 0.99
R5246:Vmn2r45 UTSW 7 8483252 missense probably benign 0.00
R5430:Vmn2r45 UTSW 7 8483334 nonsense probably null
R5504:Vmn2r45 UTSW 7 8483177 missense probably benign 0.03
R5511:Vmn2r45 UTSW 7 8471833 missense probably benign 0.19
R5745:Vmn2r45 UTSW 7 8483075 missense probably benign 0.00
R5814:Vmn2r45 UTSW 7 8471476 missense probably benign 0.00
R6223:Vmn2r45 UTSW 7 8483302 missense probably benign
R6267:Vmn2r45 UTSW 7 8472208 missense probably benign 0.26
R6623:Vmn2r45 UTSW 7 8471501 missense probably benign 0.09
U24488:Vmn2r45 UTSW 7 8472362 missense probably damaging 1.00
Z1088:Vmn2r45 UTSW 7 8471485 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CACAGCAACCATGTGTTTGCCC -3'
(R):5'- ACAGTCACTGTGGTTCTGGCTTTC -3'

Sequencing Primer
(F):5'- CCATGTGTTTGCCCTTGGTG -3'
(R):5'- GGCTTTCAAAGTCACAGACC -3'
Posted On2014-04-13