Incidental Mutation 'R1580:Cyp2a4'
ID171351
Institutional Source Beutler Lab
Gene Symbol Cyp2a4
Ensembl Gene ENSMUSG00000074254
Gene Namecytochrome P450, family 2, subfamily a, polypeptide 4
SynonymsD7Ucla4, Cyp15a1, testosterone 15alpha-hydroxylase
MMRRC Submission 039617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R1580 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26307169-26315088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26307651 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 61 (I61T)
Ref Sequence ENSEMBL: ENSMUSP00000096254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098657]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098657
AA Change: I61T

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096254
Gene: ENSMUSG00000074254
AA Change: I61T

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 34 491 8.9e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206226
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,965 V2044I possibly damaging Het
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp2c2 A G 8: 119,752,987 N752D probably benign Het
Atp6v0a1 T C 11: 101,029,204 I221T probably damaging Het
Atp8b5 T C 4: 43,355,673 V551A possibly damaging Het
B3galnt1 A G 3: 69,575,707 S74P possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Brms1l A T 12: 55,868,222 K305N probably damaging Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Chst9 T G 18: 15,453,065 K147T probably benign Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Clec5a G T 6: 40,585,219 H4N probably benign Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Dok2 A G 14: 70,776,957 D195G probably benign Het
Emilin1 A G 5: 30,917,420 E335G probably damaging Het
Fam205c T C 4: 42,874,020 probably null Het
Gm7361 G T 5: 26,257,770 L3F probably damaging Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Lins1 C A 7: 66,714,491 D711E probably benign Het
Mbtps1 C T 8: 119,538,900 V303I possibly damaging Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr299 A G 7: 86,465,450 E13G probably benign Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Vmn2r45 T G 7: 8,471,747 S761R possibly damaging Het
Zfp580 C T 7: 5,053,285 R215C probably damaging Het
Zfpm2 A G 15: 41,103,209 D898G possibly damaging Het
Other mutations in Cyp2a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Cyp2a4 APN 7 26308544 missense probably damaging 1.00
IGL01609:Cyp2a4 APN 7 26308663 critical splice donor site probably null
IGL01959:Cyp2a4 APN 7 26307708 missense probably damaging 1.00
IGL02282:Cyp2a4 APN 7 26309047 missense probably benign 0.01
IGL03053:Cyp2a4 APN 7 26313550 splice site probably benign
IGL03168:Cyp2a4 APN 7 26313550 splice site probably benign
R0393:Cyp2a4 UTSW 7 26312868 missense possibly damaging 0.67
R0453:Cyp2a4 UTSW 7 26312833 missense probably benign 0.22
R0825:Cyp2a4 UTSW 7 26312916 missense probably benign 0.07
R0948:Cyp2a4 UTSW 7 26310788 missense probably damaging 1.00
R1215:Cyp2a4 UTSW 7 26314801 missense possibly damaging 0.75
R1222:Cyp2a4 UTSW 7 26308588 missense possibly damaging 0.70
R1374:Cyp2a4 UTSW 7 26312923 missense probably damaging 0.99
R1473:Cyp2a4 UTSW 7 26314763 missense probably benign
R1768:Cyp2a4 UTSW 7 26312772 missense possibly damaging 0.94
R1832:Cyp2a4 UTSW 7 26312210 missense probably damaging 0.99
R1911:Cyp2a4 UTSW 7 26308974 missense possibly damaging 0.85
R2080:Cyp2a4 UTSW 7 26308537 missense possibly damaging 0.96
R2086:Cyp2a4 UTSW 7 26312308 missense probably damaging 1.00
R2259:Cyp2a4 UTSW 7 26309035 missense probably damaging 0.99
R2877:Cyp2a4 UTSW 7 26312187 missense possibly damaging 0.95
R2878:Cyp2a4 UTSW 7 26312187 missense possibly damaging 0.95
R3732:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3732:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3733:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3734:Cyp2a4 UTSW 7 26312827 missense probably damaging 1.00
R3741:Cyp2a4 UTSW 7 26308544 missense probably damaging 1.00
R4079:Cyp2a4 UTSW 7 26307366 missense probably benign 0.22
R4297:Cyp2a4 UTSW 7 26307368 missense probably damaging 0.96
R4785:Cyp2a4 UTSW 7 26312875 missense probably damaging 1.00
R4998:Cyp2a4 UTSW 7 26307361 missense probably damaging 1.00
R5297:Cyp2a4 UTSW 7 26312204 missense probably benign 0.07
R5893:Cyp2a4 UTSW 7 26308928 missense probably damaging 1.00
R5942:Cyp2a4 UTSW 7 26310704 critical splice acceptor site probably null
R6262:Cyp2a4 UTSW 7 26312230 missense probably damaging 0.99
R6612:Cyp2a4 UTSW 7 26308647 missense probably benign 0.00
R6722:Cyp2a4 UTSW 7 26313558 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAACTCTCTCATGAAGGTGCCACTG -3'
(R):5'- ATGATGCTCTCAAATGTCCTCTGCC -3'

Sequencing Primer
(F):5'- CCACTGGGCATGGAGATG -3'
(R):5'- TCATTCCCCTGTGTCAAGAC -3'
Posted On2014-04-13