Incidental Mutation 'R1580:Olfr299'
ID171355
Institutional Source Beutler Lab
Gene Symbol Olfr299
Ensembl Gene ENSMUSG00000020168
Gene Nameolfactory receptor 299
SynonymsGA_x6K02T2NHDJ-9643949-9642957, MOR221-2
MMRRC Submission 039617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R1580 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86459921-86469557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86465450 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 13 (E13G)
Ref Sequence ENSEMBL: ENSMUSP00000149038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057734] [ENSMUST00000217253]
Predicted Effect probably benign
Transcript: ENSMUST00000057734
AA Change: E13G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000062434
Gene: ENSMUSG00000020168
AA Change: E13G

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 4.7e-46 PFAM
Pfam:7tm_1 39 289 4.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217253
AA Change: E13G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.1332 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,965 V2044I possibly damaging Het
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp2c2 A G 8: 119,752,987 N752D probably benign Het
Atp6v0a1 T C 11: 101,029,204 I221T probably damaging Het
Atp8b5 T C 4: 43,355,673 V551A possibly damaging Het
B3galnt1 A G 3: 69,575,707 S74P possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Brms1l A T 12: 55,868,222 K305N probably damaging Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Chst9 T G 18: 15,453,065 K147T probably benign Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Clec5a G T 6: 40,585,219 H4N probably benign Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp2a4 T C 7: 26,307,651 I61T possibly damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Dok2 A G 14: 70,776,957 D195G probably benign Het
Emilin1 A G 5: 30,917,420 E335G probably damaging Het
Fam205c T C 4: 42,874,020 probably null Het
Gm7361 G T 5: 26,257,770 L3F probably damaging Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Lins1 C A 7: 66,714,491 D711E probably benign Het
Mbtps1 C T 8: 119,538,900 V303I possibly damaging Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Vmn2r45 T G 7: 8,471,747 S761R possibly damaging Het
Zfp580 C T 7: 5,053,285 R215C probably damaging Het
Zfpm2 A G 15: 41,103,209 D898G possibly damaging Het
Other mutations in Olfr299
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Olfr299 APN 7 86466272 missense probably damaging 1.00
R1300:Olfr299 UTSW 7 86465743 missense probably benign
R1653:Olfr299 UTSW 7 86466212 missense probably benign 0.01
R2183:Olfr299 UTSW 7 86466386 missense probably benign
R2190:Olfr299 UTSW 7 86466365 missense possibly damaging 0.78
R4839:Olfr299 UTSW 7 86465909 missense probably damaging 1.00
R5405:Olfr299 UTSW 7 86466175 missense probably damaging 1.00
R6458:Olfr299 UTSW 7 86465680 missense probably damaging 0.99
R6783:Olfr299 UTSW 7 86465627 missense probably damaging 0.99
R6902:Olfr299 UTSW 7 86465787 nonsense probably null
X0050:Olfr299 UTSW 7 86465603 missense possibly damaging 0.91
Z1088:Olfr299 UTSW 7 86465746 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CTCGTGAATGCAAGATTGAATGTGCC -3'
(R):5'- TGCACACCCAGTCACAGAAATATTCC -3'

Sequencing Primer
(F):5'- gatagatagatagatggatggatggg -3'
(R):5'- CAAGCATTTGGGACAGTGAC -3'
Posted On2014-04-13