Incidental Mutation 'R1580:Atp2c2'
ID171359
Institutional Source Beutler Lab
Gene Symbol Atp2c2
Ensembl Gene ENSMUSG00000034112
Gene NameATPase, Ca++ transporting, type 2C, member 2
Synonyms
MMRRC Submission 039617-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.500) question?
Stock #R1580 (G1)
Quality Score202
Status Validated
Chromosome8
Chromosomal Location119700009-119757717 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119752987 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 752 (N752D)
Ref Sequence ENSEMBL: ENSMUSP00000092794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095171]
Predicted Effect probably benign
Transcript: ENSMUST00000095171
AA Change: N752D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: N752D

DomainStartEndE-ValueType
Cation_ATPase_N 54 128 1.27e-12 SMART
Pfam:E1-E2_ATPase 133 366 1.7e-62 PFAM
Pfam:Hydrolase 371 684 5.3e-18 PFAM
Pfam:HAD 374 681 7.4e-11 PFAM
Pfam:Cation_ATPase 437 521 1.1e-17 PFAM
Pfam:Cation_ATPase_C 754 927 1.1e-47 PFAM
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,965 V2044I possibly damaging Het
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp6v0a1 T C 11: 101,029,204 I221T probably damaging Het
Atp8b5 T C 4: 43,355,673 V551A possibly damaging Het
B3galnt1 A G 3: 69,575,707 S74P possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Brms1l A T 12: 55,868,222 K305N probably damaging Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Chst9 T G 18: 15,453,065 K147T probably benign Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Clec5a G T 6: 40,585,219 H4N probably benign Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp2a4 T C 7: 26,307,651 I61T possibly damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Dok2 A G 14: 70,776,957 D195G probably benign Het
Emilin1 A G 5: 30,917,420 E335G probably damaging Het
Fam205c T C 4: 42,874,020 probably null Het
Gm7361 G T 5: 26,257,770 L3F probably damaging Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Lins1 C A 7: 66,714,491 D711E probably benign Het
Mbtps1 C T 8: 119,538,900 V303I possibly damaging Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr299 A G 7: 86,465,450 E13G probably benign Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Vmn2r45 T G 7: 8,471,747 S761R possibly damaging Het
Zfp580 C T 7: 5,053,285 R215C probably damaging Het
Zfpm2 A G 15: 41,103,209 D898G possibly damaging Het
Other mutations in Atp2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Atp2c2 APN 8 119745590 missense probably benign
IGL01624:Atp2c2 APN 8 119757450 missense probably benign 0.00
IGL02133:Atp2c2 APN 8 119754335 missense probably benign 0.00
IGL02221:Atp2c2 APN 8 119744334 missense probably damaging 1.00
IGL02606:Atp2c2 APN 8 119730274 missense probably benign
IGL02657:Atp2c2 APN 8 119753032 missense probably damaging 1.00
IGL02839:Atp2c2 APN 8 119749120 missense possibly damaging 0.85
IGL03122:Atp2c2 APN 8 119742675 missense possibly damaging 0.77
R0031:Atp2c2 UTSW 8 119749062 missense probably benign 0.15
R0372:Atp2c2 UTSW 8 119757441 missense probably benign
R0502:Atp2c2 UTSW 8 119734577 missense probably null 0.99
R0503:Atp2c2 UTSW 8 119734577 missense probably null 0.99
R0584:Atp2c2 UTSW 8 119738418 missense probably benign 0.01
R1225:Atp2c2 UTSW 8 119735245 missense probably damaging 1.00
R1620:Atp2c2 UTSW 8 119749126 missense probably benign
R1638:Atp2c2 UTSW 8 119756003 missense possibly damaging 0.82
R1745:Atp2c2 UTSW 8 119725094 missense probably benign 0.02
R1746:Atp2c2 UTSW 8 119734443 unclassified probably benign
R1907:Atp2c2 UTSW 8 119749876 splice site probably benign
R2104:Atp2c2 UTSW 8 119749845 missense probably benign
R2151:Atp2c2 UTSW 8 119756102 missense probably benign
R2152:Atp2c2 UTSW 8 119756102 missense probably benign
R2154:Atp2c2 UTSW 8 119756102 missense probably benign
R2207:Atp2c2 UTSW 8 119748309 missense probably damaging 1.00
R3874:Atp2c2 UTSW 8 119735296 missense possibly damaging 0.74
R3912:Atp2c2 UTSW 8 119721276 missense probably damaging 1.00
R4093:Atp2c2 UTSW 8 119749871 critical splice donor site probably null
R4782:Atp2c2 UTSW 8 119749152 missense probably damaging 0.97
R4801:Atp2c2 UTSW 8 119747687 missense probably damaging 1.00
R4973:Atp2c2 UTSW 8 119754263 missense probably benign 0.00
R5485:Atp2c2 UTSW 8 119753062 critical splice donor site probably null
R5978:Atp2c2 UTSW 8 119749875 splice site probably null
R6377:Atp2c2 UTSW 8 119726354 missense probably benign 0.10
R6613:Atp2c2 UTSW 8 119756021 missense probably damaging 0.99
R6765:Atp2c2 UTSW 8 119753017 missense probably damaging 1.00
R6836:Atp2c2 UTSW 8 119734415 missense probably damaging 1.00
R6963:Atp2c2 UTSW 8 119730267 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCAAGGGCATCTTCTACAACATC -3'
(R):5'- ACATTTTCCCATCAGTGAAAGGCGG -3'

Sequencing Primer
(F):5'- ATCAAGAACTTTGTCCGTTTCCAG -3'
(R):5'- CTGACTTTACAGTGGGACCGAG -3'
Posted On2014-04-13