Incidental Mutation 'R1580:Atp6v0a1'
ID171364
Institutional Source Beutler Lab
Gene Symbol Atp6v0a1
Ensembl Gene ENSMUSG00000019302
Gene NameATPase, H+ transporting, lysosomal V0 subunit A1
SynonymsAtp6n1a, Vpp-1, Vpp1, V-ATPase a1, Atp6n1
MMRRC Submission 039617-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1580 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101009452-101063719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101029204 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 221 (I221T)
Ref Sequence ENSEMBL: ENSMUSP00000131848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044721] [ENSMUST00000092663] [ENSMUST00000103110] [ENSMUST00000168757]
Predicted Effect probably damaging
Transcript: ENSMUST00000044721
AA Change: I221T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044838
Gene: ENSMUSG00000019302
AA Change: I221T

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092663
AA Change: I221T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090333
Gene: ENSMUSG00000019302
AA Change: I221T

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 823 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103110
AA Change: I228T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099399
Gene: ENSMUSG00000019302
AA Change: I228T

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154896
Predicted Effect probably damaging
Transcript: ENSMUST00000168757
AA Change: I221T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131848
Gene: ENSMUSG00000019302
AA Change: I221T

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185166
Meta Mutation Damage Score 0.266 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three A subunit proteins and the encoded protein is associated with clathrin-coated vesicles. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,965 V2044I possibly damaging Het
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp2c2 A G 8: 119,752,987 N752D probably benign Het
Atp8b5 T C 4: 43,355,673 V551A possibly damaging Het
B3galnt1 A G 3: 69,575,707 S74P possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Brms1l A T 12: 55,868,222 K305N probably damaging Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Chst9 T G 18: 15,453,065 K147T probably benign Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Clec5a G T 6: 40,585,219 H4N probably benign Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp2a4 T C 7: 26,307,651 I61T possibly damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Dok2 A G 14: 70,776,957 D195G probably benign Het
Emilin1 A G 5: 30,917,420 E335G probably damaging Het
Fam205c T C 4: 42,874,020 probably null Het
Gm7361 G T 5: 26,257,770 L3F probably damaging Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Lins1 C A 7: 66,714,491 D711E probably benign Het
Mbtps1 C T 8: 119,538,900 V303I possibly damaging Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr299 A G 7: 86,465,450 E13G probably benign Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Vmn2r45 T G 7: 8,471,747 S761R possibly damaging Het
Zfp580 C T 7: 5,053,285 R215C probably damaging Het
Zfpm2 A G 15: 41,103,209 D898G possibly damaging Het
Other mutations in Atp6v0a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Atp6v0a1 APN 11 101030505 critical splice donor site probably null
IGL01024:Atp6v0a1 APN 11 101048439 missense probably benign 0.00
IGL01390:Atp6v0a1 APN 11 101043802 missense probably benign 0.01
IGL02214:Atp6v0a1 APN 11 101039840 missense probably benign 0.01
IGL02639:Atp6v0a1 APN 11 101055518 missense possibly damaging 0.90
R0125:Atp6v0a1 UTSW 11 101038851 splice site probably null
R0193:Atp6v0a1 UTSW 11 101048482 missense possibly damaging 0.90
R0265:Atp6v0a1 UTSW 11 101048515 missense possibly damaging 0.80
R0973:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R0973:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R0974:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R1460:Atp6v0a1 UTSW 11 101033998 missense probably damaging 1.00
R1625:Atp6v0a1 UTSW 11 101055554 missense probably damaging 1.00
R1644:Atp6v0a1 UTSW 11 101038786 missense possibly damaging 0.65
R1779:Atp6v0a1 UTSW 11 101026685 missense probably benign 0.01
R2895:Atp6v0a1 UTSW 11 101044598 missense probably benign
R2926:Atp6v0a1 UTSW 11 101043948 missense probably damaging 0.99
R3727:Atp6v0a1 UTSW 11 101030420 missense probably benign 0.01
R3943:Atp6v0a1 UTSW 11 101055517 missense probably benign 0.00
R4820:Atp6v0a1 UTSW 11 101042950 missense probably benign 0.00
R5119:Atp6v0a1 UTSW 11 101020515 missense probably benign 0.02
R5250:Atp6v0a1 UTSW 11 101043044 missense possibly damaging 0.94
R5377:Atp6v0a1 UTSW 11 101055587 missense probably damaging 1.00
R5393:Atp6v0a1 UTSW 11 101038807 missense possibly damaging 0.95
R5497:Atp6v0a1 UTSW 11 101029185 missense probably damaging 1.00
R5787:Atp6v0a1 UTSW 11 101018574 missense probably benign 0.04
R6054:Atp6v0a1 UTSW 11 101039889 missense possibly damaging 0.91
R6076:Atp6v0a1 UTSW 11 101055060 missense probably damaging 1.00
R6889:Atp6v0a1 UTSW 11 101029183 missense possibly damaging 0.87
R7035:Atp6v0a1 UTSW 11 101027357 missense probably damaging 0.97
R7084:Atp6v0a1 UTSW 11 101034042 missense probably damaging 1.00
R7212:Atp6v0a1 UTSW 11 101043957 missense probably benign 0.08
X0023:Atp6v0a1 UTSW 11 101044597 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCTTAAAGATTCGTTCTGATGCCACC -3'
(R):5'- ACTCCTAATGTCATTCCCAGTGAAAGC -3'

Sequencing Primer
(F):5'- cctgtaagcccagcactc -3'
(R):5'- GTCATTCCCAGTGAAAGCAGAAC -3'
Posted On2014-04-13