Incidental Mutation 'R1580:Dok2'
ID171367
Institutional Source Beutler Lab
Gene Symbol Dok2
Ensembl Gene ENSMUSG00000022102
Gene Namedocking protein 2
SynonymsFrip, DokR, Frip
MMRRC Submission 039617-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock #R1580 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location70766036-70778495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70776957 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 195 (D195G)
Ref Sequence ENSEMBL: ENSMUSP00000022698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022698]
Predicted Effect probably benign
Transcript: ENSMUST00000022698
AA Change: D195G

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022698
Gene: ENSMUSG00000022102
AA Change: D195G

DomainStartEndE-ValueType
PH 8 119 2.32e-9 SMART
PTBI 150 249 3.65e-42 SMART
IRS 153 249 5.18e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171864
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is constitutively tyrosine phosphorylated in hematopoietic progenitors isolated from chronic myelogenous leukemia (CML) patients in the chronic phase. It may be a critical substrate for p210(bcr/abl), a chimeric protein whose presence is associated with CML. This encoded protein binds p120 (RasGAP) from CML cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal granulocyte physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,965 V2044I possibly damaging Het
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp2c2 A G 8: 119,752,987 N752D probably benign Het
Atp6v0a1 T C 11: 101,029,204 I221T probably damaging Het
Atp8b5 T C 4: 43,355,673 V551A possibly damaging Het
B3galnt1 A G 3: 69,575,707 S74P possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Brms1l A T 12: 55,868,222 K305N probably damaging Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Chst9 T G 18: 15,453,065 K147T probably benign Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Clec5a G T 6: 40,585,219 H4N probably benign Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp2a4 T C 7: 26,307,651 I61T possibly damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Emilin1 A G 5: 30,917,420 E335G probably damaging Het
Fam205c T C 4: 42,874,020 probably null Het
Gm7361 G T 5: 26,257,770 L3F probably damaging Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Lins1 C A 7: 66,714,491 D711E probably benign Het
Mbtps1 C T 8: 119,538,900 V303I possibly damaging Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr299 A G 7: 86,465,450 E13G probably benign Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Vmn2r45 T G 7: 8,471,747 S761R possibly damaging Het
Zfp580 C T 7: 5,053,285 R215C probably damaging Het
Zfpm2 A G 15: 41,103,209 D898G possibly damaging Het
Other mutations in Dok2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02095:Dok2 APN 14 70777861 missense possibly damaging 0.89
R1631:Dok2 UTSW 14 70776953 missense probably damaging 1.00
R4783:Dok2 UTSW 14 70777874 missense probably benign 0.27
R4784:Dok2 UTSW 14 70777874 missense probably benign 0.27
R4860:Dok2 UTSW 14 70777516 missense probably damaging 1.00
R4860:Dok2 UTSW 14 70777516 missense probably damaging 1.00
R6339:Dok2 UTSW 14 70775718 missense probably benign 0.00
R6939:Dok2 UTSW 14 70775605 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGCCCACTGTTTCCTGAAGCTG -3'
(R):5'- CCACATGGAAAAGTGCTGACCCTG -3'

Sequencing Primer
(F):5'- GTTTCCTGAAGCTGCCTCTC -3'
(R):5'- cttcaactctgtctcctgcc -3'
Posted On2014-04-13