Incidental Mutation 'R1580:Zfpm2'
ID171368
Institutional Source Beutler Lab
Gene Symbol Zfpm2
Ensembl Gene ENSMUSG00000022306
Gene Namezinc finger protein, multitype 2
SynonymsB330005D23Rik, FOG2, FOG-2
MMRRC Submission 039617-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1580 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location40655035-41104592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41103209 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 898 (D898G)
Ref Sequence ENSEMBL: ENSMUSP00000155094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053467
AA Change: D1030G

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: D1030G

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
ZnF_C2H2 250 270 4.27e1 SMART
ZnF_C2H2 296 320 1.25e-1 SMART
ZnF_C2H2 335 357 4.05e-1 SMART
ZnF_C2H2 363 385 6.23e-2 SMART
ZnF_C2H2 548 569 1.43e1 SMART
ZnF_C2H2 687 714 1.06e2 SMART
low complexity region 731 741 N/A INTRINSIC
ZnF_C2H2 854 874 5.4e1 SMART
ZnF_C2H2 1119 1145 4.99e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000230319
AA Change: D898G

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,965 V2044I possibly damaging Het
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp2c2 A G 8: 119,752,987 N752D probably benign Het
Atp6v0a1 T C 11: 101,029,204 I221T probably damaging Het
Atp8b5 T C 4: 43,355,673 V551A possibly damaging Het
B3galnt1 A G 3: 69,575,707 S74P possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Brms1l A T 12: 55,868,222 K305N probably damaging Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Chst9 T G 18: 15,453,065 K147T probably benign Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Clec5a G T 6: 40,585,219 H4N probably benign Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp2a4 T C 7: 26,307,651 I61T possibly damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Dok2 A G 14: 70,776,957 D195G probably benign Het
Emilin1 A G 5: 30,917,420 E335G probably damaging Het
Fam205c T C 4: 42,874,020 probably null Het
Gm7361 G T 5: 26,257,770 L3F probably damaging Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Lins1 C A 7: 66,714,491 D711E probably benign Het
Mbtps1 C T 8: 119,538,900 V303I possibly damaging Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr299 A G 7: 86,465,450 E13G probably benign Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Vmn2r45 T G 7: 8,471,747 S761R possibly damaging Het
Zfp580 C T 7: 5,053,285 R215C probably damaging Het
Other mutations in Zfpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zfpm2 APN 15 41099287 missense probably damaging 1.00
IGL00815:Zfpm2 APN 15 41099491 missense probably benign 0.37
IGL00821:Zfpm2 APN 15 41103387 missense probably damaging 1.00
IGL01622:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01623:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01807:Zfpm2 APN 15 40753056 critical splice donor site probably null
IGL01872:Zfpm2 APN 15 41102387 missense probably benign
IGL02087:Zfpm2 APN 15 41103121 missense probably damaging 0.97
IGL02123:Zfpm2 APN 15 41102195 missense probably damaging 1.00
IGL02355:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02362:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02579:Zfpm2 APN 15 41099472 missense possibly damaging 0.91
IGL02752:Zfpm2 APN 15 41102019 missense probably benign 0.23
IGL02792:Zfpm2 APN 15 41103013 missense probably benign 0.00
IGL02861:Zfpm2 APN 15 41103266 missense probably damaging 0.98
IGL03180:Zfpm2 APN 15 41101394 missense probably damaging 1.00
IGL03344:Zfpm2 APN 15 41102774 missense probably benign
R0305:Zfpm2 UTSW 15 40774035 splice site probably benign
R0365:Zfpm2 UTSW 15 40774066 missense possibly damaging 0.88
R1171:Zfpm2 UTSW 15 41101679 missense probably damaging 1.00
R1456:Zfpm2 UTSW 15 41102481 missense probably damaging 1.00
R1482:Zfpm2 UTSW 15 41099291 missense probably damaging 1.00
R2119:Zfpm2 UTSW 15 41103023 missense probably damaging 1.00
R2189:Zfpm2 UTSW 15 41101183 missense possibly damaging 0.76
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2886:Zfpm2 UTSW 15 41102323 missense probably benign 0.44
R3024:Zfpm2 UTSW 15 41102959 missense probably benign 0.00
R4043:Zfpm2 UTSW 15 40870627 missense possibly damaging 0.94
R4178:Zfpm2 UTSW 15 41103544 missense probably damaging 1.00
R4465:Zfpm2 UTSW 15 41096161 missense probably benign 0.00
R5263:Zfpm2 UTSW 15 41099395 missense probably benign 0.45
R5266:Zfpm2 UTSW 15 41099469 missense probably benign 0.01
R5352:Zfpm2 UTSW 15 40870542 missense probably benign 0.01
R5584:Zfpm2 UTSW 15 41102537 missense probably benign 0.45
R5661:Zfpm2 UTSW 15 41096071 nonsense probably null
R6437:Zfpm2 UTSW 15 41099397 missense probably benign
R6660:Zfpm2 UTSW 15 40655585 critical splice donor site probably null
R6742:Zfpm2 UTSW 15 41101718 missense probably benign
R6749:Zfpm2 UTSW 15 40954708 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CGAAGCAGCTCAGCTCATTGCTAC -3'
(R):5'- TGGGTTCTCAGAGATCCACGAAGG -3'

Sequencing Primer
(F):5'- AATGCCTTTACCCTGGAGC -3'
(R):5'- CACGAAGGGGATTTGTGGC -3'
Posted On2014-04-13