Incidental Mutation 'R1580:Chst9'
ID171370
Institutional Source Beutler Lab
Gene Symbol Chst9
Ensembl Gene ENSMUSG00000047161
Gene Namecarbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
Synonyms5430438D01Rik, GalNAc4ST-2
MMRRC Submission 039617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R1580 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location15451924-15760157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 15453065 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 147 (K147T)
Ref Sequence ENSEMBL: ENSMUSP00000049975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053017] [ENSMUST00000130553]
Predicted Effect probably benign
Transcript: ENSMUST00000053017
AA Change: K147T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000049975
Gene: ENSMUSG00000047161
AA Change: K147T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
Pfam:Sulfotransfer_2 174 409 1.9e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130553
SMART Domains Protein: ENSMUSP00000121484
Gene: ENSMUSG00000047161

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Meta Mutation Damage Score 0.002 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.8%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sulfotransferase 2 family. It is localized to the golgi membrane, and catalyzes the transfer of sulfate to position 4 of non-reducing N-acetylgalactosamine (GalNAc) residues in both N-glycans and O-glycans. Sulfate groups on carbohydrates confer highly specific functions to glycoproteins, glycolipids, and proteoglycans, and are critical for cell-cell interaction, signal transduction, and embryonic development. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,965 V2044I possibly damaging Het
Adgrv1 A G 13: 81,466,160 probably null Het
Arhgef38 T C 3: 133,133,704 Q526R probably benign Het
Atp2c2 A G 8: 119,752,987 N752D probably benign Het
Atp6v0a1 T C 11: 101,029,204 I221T probably damaging Het
Atp8b5 T C 4: 43,355,673 V551A possibly damaging Het
B3galnt1 A G 3: 69,575,707 S74P possibly damaging Het
Bcl2l13 A G 6: 120,865,714 I123V probably benign Het
Brms1l A T 12: 55,868,222 K305N probably damaging Het
Ccdc82 C T 9: 13,252,760 R226C probably damaging Het
Clec16a A G 16: 10,595,898 R390G probably damaging Het
Clec5a G T 6: 40,585,219 H4N probably benign Het
Csmd1 T A 8: 15,925,299 Q2970L probably damaging Het
Cyp2a4 T C 7: 26,307,651 I61T possibly damaging Het
Cyp3a16 T A 5: 145,442,074 K379I possibly damaging Het
Cyp3a16 T C 5: 145,442,075 K379E probably damaging Het
Dok2 A G 14: 70,776,957 D195G probably benign Het
Emilin1 A G 5: 30,917,420 E335G probably damaging Het
Fam205c T C 4: 42,874,020 probably null Het
Gm7361 G T 5: 26,257,770 L3F probably damaging Het
Haus1 T C 18: 77,766,920 D50G probably damaging Het
Igf1r T C 7: 68,207,869 V1099A probably benign Het
Kif15 T C 9: 122,959,956 V71A probably benign Het
Klk10 C T 7: 43,782,862 A73V probably damaging Het
Lins1 C A 7: 66,714,491 D711E probably benign Het
Mbtps1 C T 8: 119,538,900 V303I possibly damaging Het
Mest G A 6: 30,745,823 probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr299 A G 7: 86,465,450 E13G probably benign Het
Olfr800 G T 10: 129,660,315 V170F probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Sbspon C A 1: 15,892,468 C62F probably damaging Het
Spg7 T A 8: 123,090,238 probably benign Het
Trabd2b T C 4: 114,580,334 V236A possibly damaging Het
Vmn2r10 A T 5: 109,006,251 N62K possibly damaging Het
Vmn2r45 T G 7: 8,471,747 S761R possibly damaging Het
Zfp580 C T 7: 5,053,285 R215C probably damaging Het
Zfpm2 A G 15: 41,103,209 D898G possibly damaging Het
Other mutations in Chst9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Chst9 APN 18 15453030 missense probably benign 0.34
IGL01910:Chst9 APN 18 15452874 missense possibly damaging 0.90
IGL03038:Chst9 APN 18 15495303 missense probably benign
IGL03146:Chst9 APN 18 15452978 missense probably damaging 1.00
R0536:Chst9 UTSW 18 15495330 splice site probably benign
R0647:Chst9 UTSW 18 15452669 missense probably damaging 1.00
R1240:Chst9 UTSW 18 15453174 missense probably benign
R1892:Chst9 UTSW 18 15452960 missense probably damaging 1.00
R2420:Chst9 UTSW 18 15452284 missense probably damaging 1.00
R2446:Chst9 UTSW 18 15452838 missense possibly damaging 0.90
R4737:Chst9 UTSW 18 15452777 missense probably damaging 1.00
R4790:Chst9 UTSW 18 15453050 missense probably damaging 1.00
R4956:Chst9 UTSW 18 15717988 missense probably damaging 1.00
R5202:Chst9 UTSW 18 15453239 missense probably benign 0.02
R5402:Chst9 UTSW 18 15452815 missense probably damaging 0.98
R5754:Chst9 UTSW 18 15453197 missense possibly damaging 0.77
R6035:Chst9 UTSW 18 15452853 missense probably benign 0.13
R6035:Chst9 UTSW 18 15452853 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GCCTTTCCAAACACCGGATGGTAG -3'
(R):5'- TTCACAAAGGGAGAACGGAGCTTAC -3'

Sequencing Primer
(F):5'- CCCTAAATGCGGAGACTAATCTTTC -3'
(R):5'- ACGGAGCTTACAGATCAACTG -3'
Posted On2014-04-13