Incidental Mutation 'R1581:Olfr398'
ID171422
Institutional Source Beutler Lab
Gene Symbol Olfr398
Ensembl Gene ENSMUSG00000049041
Gene Nameolfactory receptor 398
SynonymsGA_x6K02T2P1NL-4141430-4140486, MOR157-1
MMRRC Submission 039618-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R1581 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73979967-73990407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73984521 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 29 (L29H)
Ref Sequence ENSEMBL: ENSMUSP00000149170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053874] [ENSMUST00000117510] [ENSMUST00000214334]
Predicted Effect probably damaging
Transcript: ENSMUST00000053874
AA Change: L29H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059548
Gene: ENSMUSG00000049041
AA Change: L29H

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.5e-5 PFAM
Pfam:7tm_1 41 290 1.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117510
AA Change: L29H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113005
Gene: ENSMUSG00000049041
AA Change: L29H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 305 3.5e-5 PFAM
Pfam:7tm_1 41 290 6.4e-28 PFAM
Pfam:7tm_4 140 283 4.7e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214334
AA Change: L29H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T C 15: 91,179,144 E447G probably benign Het
Actn4 T C 7: 28,898,646 T510A probably benign Het
Adgrb3 A G 1: 25,094,072 M1311T possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bicdl1 G T 5: 115,651,267 probably benign Het
Bmyc T C 2: 25,707,334 S137P probably damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Casc3 C T 11: 98,822,818 T292I possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cnnm2 A G 19: 46,763,123 T451A probably damaging Het
Eed T C 7: 89,980,468 K20E possibly damaging Het
Eps15 T A 4: 109,363,186 M180K probably benign Het
Esr1 T C 10: 4,997,905 I486T probably damaging Het
Etnppl A G 3: 130,628,744 I207V possibly damaging Het
Fam92a T A 4: 12,155,745 probably null Het
Fancg G A 4: 43,007,039 P246L probably damaging Het
Fcrl1 G A 3: 87,385,723 C249Y possibly damaging Het
Foxred2 A G 15: 77,955,761 F110L possibly damaging Het
Fsip2 A T 2: 82,986,282 N4120Y probably damaging Het
Gm156 T C 6: 129,775,833 D3G probably benign Het
Gm4884 C T 7: 41,043,831 S408L probably benign Het
Gm9476 T C 10: 100,306,612 noncoding transcript Het
Gria1 T C 11: 57,237,010 probably null Het
H6pd T A 4: 149,982,514 I472F possibly damaging Het
Hydin A T 8: 110,410,460 M632L probably benign Het
Hyou1 C T 9: 44,388,870 P819S probably damaging Het
Il6st A G 13: 112,481,541 E163G probably damaging Het
Kcnk1 T C 8: 125,995,539 V27A possibly damaging Het
Kdelr3 T C 15: 79,522,913 probably null Het
Klk1b22 A G 7: 44,115,975 N117S possibly damaging Het
Lpp C A 16: 24,681,841 C134* probably null Het
Lrrc37a G A 11: 103,457,017 R2951* probably null Het
Luzp2 T A 7: 55,249,490 D285E possibly damaging Het
Ly75 C T 2: 60,327,893 R1016H probably damaging Het
Mesp2 T A 7: 79,812,541 S282T possibly damaging Het
Nav3 T C 10: 109,823,428 D776G probably damaging Het
Nr2e1 T C 10: 42,567,968 T253A probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Padi6 T C 4: 140,735,836 Y146C probably damaging Het
Pank4 C T 4: 154,974,651 R414W probably damaging Het
Pclo T G 5: 14,521,282 I227S probably benign Het
Plppr4 A G 3: 117,328,266 V221A possibly damaging Het
Pradc1 G A 6: 85,448,586 R25C probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rnd2 A G 11: 101,471,196 T192A probably benign Het
Rtbdn A G 8: 84,955,066 E131G probably benign Het
Ryr2 A G 13: 11,794,563 V792A probably benign Het
Sacs G T 14: 61,213,679 Q4391H probably damaging Het
Scd2 A G 19: 44,298,099 S123G probably benign Het
Sept9 A G 11: 117,290,595 R74G probably damaging Het
Sipa1l2 T A 8: 125,491,617 Q327L probably damaging Het
Skor1 T C 9: 63,146,223 T127A probably damaging Het
Sphk2 A G 7: 45,713,496 V57A probably damaging Het
Tfec A T 6: 16,844,244 D101E probably damaging Het
Tmem43 T A 6: 91,478,735 H109Q probably benign Het
Tmem67 C A 4: 12,047,814 S839I probably damaging Het
Trpv5 T C 6: 41,653,140 Y672C probably damaging Het
Ttc39d A C 17: 80,216,484 S191R probably benign Het
Ttll1 C T 15: 83,496,277 V296M probably damaging Het
Upp2 A C 2: 58,774,165 K130T possibly damaging Het
Vmn2r5 A G 3: 64,491,219 C780R probably damaging Het
Wars C A 12: 108,875,709 E171* probably null Het
Zeb2 A T 2: 44,997,000 S637T probably damaging Het
Zfp27 T A 7: 29,896,124 T139S possibly damaging Het
Zfp941 A T 7: 140,812,120 L442Q probably benign Het
Other mutations in Olfr398
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Olfr398 APN 11 73984527 missense probably damaging 1.00
IGL01116:Olfr398 APN 11 73984318 missense probably damaging 1.00
R0242:Olfr398 UTSW 11 73983712 missense probably benign
R0242:Olfr398 UTSW 11 73983712 missense probably benign
R0647:Olfr398 UTSW 11 73983771 missense probably damaging 0.99
R0906:Olfr398 UTSW 11 73983859 missense probably damaging 0.99
R1792:Olfr398 UTSW 11 73983847 missense probably benign 0.34
R1832:Olfr398 UTSW 11 73984493 missense probably damaging 0.98
R1879:Olfr398 UTSW 11 73984542 missense probably benign 0.00
R2138:Olfr398 UTSW 11 73984303 missense probably damaging 1.00
R2988:Olfr398 UTSW 11 73983801 missense probably benign 0.13
R4557:Olfr398 UTSW 11 73984599 missense probably benign 0.25
R4606:Olfr398 UTSW 11 73983892 missense probably damaging 1.00
R4777:Olfr398 UTSW 11 73984395 missense probably benign 0.01
R4783:Olfr398 UTSW 11 73984008 missense probably damaging 0.97
R5047:Olfr398 UTSW 11 73984378 missense probably damaging 1.00
R5696:Olfr398 UTSW 11 73984536 missense possibly damaging 0.90
R6379:Olfr398 UTSW 11 73984273 missense probably damaging 1.00
X0012:Olfr398 UTSW 11 73984294 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATAGTGCAGCGGTCTACACACAGC -3'
(R):5'- TGGAAGTCCAGGAAATCTACTTGGGG -3'

Sequencing Primer
(F):5'- TCTCGGTGATACCCAGAGCTAC -3'
(R):5'- GCTGTGACCAACCTCACATA -3'
Posted On2014-04-13