Incidental Mutation 'R1582:Spata6'
ID171460
Institutional Source Beutler Lab
Gene Symbol Spata6
Ensembl Gene ENSMUSG00000034401
Gene Namespermatogenesis associated 6
Synonyms1700062C23Rik, Hash, KRP
MMRRC Submission 039619-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1582 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location111719984-111829184 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111780797 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 275 (P275S)
Ref Sequence ENSEMBL: ENSMUSP00000081383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038868] [ENSMUST00000084354] [ENSMUST00000153746]
Predicted Effect probably benign
Transcript: ENSMUST00000038868
AA Change: P275S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036964
Gene: ENSMUSG00000034401
AA Change: P275S

DomainStartEndE-ValueType
Pfam:SPATA6 11 149 3.4e-56 PFAM
low complexity region 182 198 N/A INTRINSIC
low complexity region 397 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084354
AA Change: P275S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000081383
Gene: ENSMUSG00000034401
AA Change: P275S

DomainStartEndE-ValueType
Pfam:SPATA6 10 149 1.9e-57 PFAM
low complexity region 182 198 N/A INTRINSIC
low complexity region 377 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149834
Predicted Effect probably benign
Transcript: ENSMUST00000153746
SMART Domains Protein: ENSMUSP00000114610
Gene: ENSMUSG00000034401

DomainStartEndE-ValueType
Pfam:SPATA6 10 149 3e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156179
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit abnormal formation of the sperm connecting piece during late spermiogenesis, leading to acephalic spermatozoa and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 C G 2: 31,800,359 A630G probably damaging Het
Actr3 A G 1: 125,405,925 Y202H probably benign Het
Adamts19 A G 18: 58,969,941 N685D probably damaging Het
Atl3 A G 19: 7,516,899 T138A probably damaging Het
Bpifa2 T C 2: 154,013,718 S188P probably damaging Het
Bsn T C 9: 108,105,092 T3821A unknown Het
Dcun1d2 A G 8: 13,280,926 L68P probably damaging Het
Ddhd1 A T 14: 45,605,109 L630I probably damaging Het
Ddx25 T C 9: 35,545,976 T348A probably damaging Het
Dtnb C T 12: 3,773,554 T580M possibly damaging Het
Dysf A G 6: 84,097,767 S561G probably damaging Het
Ehbp1l1 A G 19: 5,721,967 I101T possibly damaging Het
Erich3 T C 3: 154,764,323 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam135a T C 1: 24,029,317 T611A probably damaging Het
Gpbp1 T C 13: 111,436,532 probably null Het
H2-Oa A T 17: 34,094,721 T218S probably damaging Het
Kctd19 G A 8: 105,395,460 L152F probably damaging Het
Kdm5b T A 1: 134,624,853 M1189K probably damaging Het
Kif13a A G 13: 46,793,922 V862A probably benign Het
Lct T C 1: 128,300,562 T1065A probably damaging Het
Mark3 G A 12: 111,655,310 A697T probably benign Het
Mosmo A G 7: 120,730,505 I116M possibly damaging Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc15 A T 2: 110,737,472 M321L probably benign Het
Naa25 T A 5: 121,434,829 N670K probably benign Het
Olfr1336 A G 7: 6,460,814 M102V probably benign Het
Olfr376 T A 11: 73,375,264 C172S probably damaging Het
Olfr513 G T 7: 108,755,110 V85L probably benign Het
Ppara T C 15: 85,798,228 I375T possibly damaging Het
Prss27 A G 17: 24,044,903 I188V probably benign Het
Rbms1 A T 2: 60,758,835 M287K possibly damaging Het
Relt C T 7: 100,851,353 probably null Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Sec24a A G 11: 51,708,967 V837A probably benign Het
Smarca2 G A 19: 26,751,905 D19N probably damaging Het
Sorbs2 G A 8: 45,805,777 G620D probably damaging Het
Spata31d1c C A 13: 65,033,224 Q46K probably benign Het
Tas2r108 T A 6: 40,493,632 V14D probably benign Het
Thbs2 G T 17: 14,671,288 P996T probably damaging Het
Tmem131l T C 3: 83,931,783 Q620R probably damaging Het
Ubap2l A G 3: 90,034,671 S203P probably damaging Het
Unc45b G A 11: 82,925,945 G404S probably benign Het
Uri1 A G 7: 37,965,386 S292P possibly damaging Het
Usp21 A T 1: 171,283,081 C444S probably damaging Het
Vmn1r117 A T 7: 20,883,559 V188D possibly damaging Het
Vmn1r7 T C 6: 57,025,158 D39G probably damaging Het
Wdr25 T C 12: 108,898,054 F42L possibly damaging Het
Other mutations in Spata6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Spata6 APN 4 111805928 splice site probably benign
IGL02110:Spata6 APN 4 111784806 missense possibly damaging 0.53
IGL03181:Spata6 APN 4 111822766 missense probably benign 0.11
PIT4378001:Spata6 UTSW 4 111746181 missense possibly damaging 0.71
R0043:Spata6 UTSW 4 111780805 missense probably damaging 0.98
R1199:Spata6 UTSW 4 111799145 missense possibly damaging 0.53
R1491:Spata6 UTSW 4 111746191 missense probably damaging 0.99
R1548:Spata6 UTSW 4 111779006 missense probably benign 0.18
R1582:Spata6 UTSW 4 111780795 nonsense probably null
R4690:Spata6 UTSW 4 111774826 missense probably damaging 1.00
R5123:Spata6 UTSW 4 111768795 missense possibly damaging 0.71
R5360:Spata6 UTSW 4 111822829 missense possibly damaging 0.96
R5373:Spata6 UTSW 4 111822834 critical splice donor site probably null
R5396:Spata6 UTSW 4 111799118 missense probably damaging 1.00
R5919:Spata6 UTSW 4 111779208 missense probably damaging 0.96
R6017:Spata6 UTSW 4 111774827 missense probably damaging 1.00
R6476:Spata6 UTSW 4 111774823 missense probably damaging 1.00
R6573:Spata6 UTSW 4 111779279 missense probably damaging 1.00
R6807:Spata6 UTSW 4 111784815 missense probably benign 0.01
X0066:Spata6 UTSW 4 111828304 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAAGCACTGTGGAATTCACCTGC -3'
(R):5'- AGACCCTAGCTCCAGGCAATTAGC -3'

Sequencing Primer
(F):5'- TGGAATTCACCTGCTGTGTG -3'
(R):5'- cccctctctctctctctctg -3'
Posted On2014-04-13