Incidental Mutation 'R1582:Naa25'
ID171463
Institutional Source Beutler Lab
Gene Symbol Naa25
Ensembl Gene ENSMUSG00000042719
Gene NameN(alpha)-acetyltransferase 25, NatB auxiliary subunit
SynonymsC330023M02Rik, 4833422K13Rik
MMRRC Submission 039619-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1582 (G1)
Quality Score186
Status Not validated
Chromosome5
Chromosomal Location121397936-121444378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121434829 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 670 (N670K)
Ref Sequence ENSEMBL: ENSMUSP00000038977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042163] [ENSMUST00000151458] [ENSMUST00000153758] [ENSMUST00000173895]
Predicted Effect probably benign
Transcript: ENSMUST00000042163
AA Change: N670K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038977
Gene: ENSMUSG00000042719
AA Change: N670K

DomainStartEndE-ValueType
low complexity region 35 45 N/A INTRINSIC
Pfam:NatB_MDM20 263 658 1.6e-121 PFAM
low complexity region 672 683 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
low complexity region 721 734 N/A INTRINSIC
low complexity region 915 935 N/A INTRINSIC
low complexity region 958 971 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151458
SMART Domains Protein: ENSMUSP00000120970
Gene: ENSMUSG00000042719

DomainStartEndE-ValueType
SCOP:d1a17__ 21 94 1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153758
SMART Domains Protein: ENSMUSP00000122522
Gene: ENSMUSG00000029616

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
SCOP:d1g7ea_ 35 55 3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172908
SMART Domains Protein: ENSMUSP00000134345
Gene: ENSMUSG00000042719

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173895
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the auxiliary subunit of the heteromeric N-terminal acetyltransferase B complex. This complex acetylates methionine residues that are followed by acidic or asparagine residues.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 C G 2: 31,800,359 A630G probably damaging Het
Actr3 A G 1: 125,405,925 Y202H probably benign Het
Adamts19 A G 18: 58,969,941 N685D probably damaging Het
Atl3 A G 19: 7,516,899 T138A probably damaging Het
Bpifa2 T C 2: 154,013,718 S188P probably damaging Het
Bsn T C 9: 108,105,092 T3821A unknown Het
Dcun1d2 A G 8: 13,280,926 L68P probably damaging Het
Ddhd1 A T 14: 45,605,109 L630I probably damaging Het
Ddx25 T C 9: 35,545,976 T348A probably damaging Het
Dtnb C T 12: 3,773,554 T580M possibly damaging Het
Dysf A G 6: 84,097,767 S561G probably damaging Het
Ehbp1l1 A G 19: 5,721,967 I101T possibly damaging Het
Erich3 T C 3: 154,764,323 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam135a T C 1: 24,029,317 T611A probably damaging Het
Gpbp1 T C 13: 111,436,532 probably null Het
H2-Oa A T 17: 34,094,721 T218S probably damaging Het
Kctd19 G A 8: 105,395,460 L152F probably damaging Het
Kdm5b T A 1: 134,624,853 M1189K probably damaging Het
Kif13a A G 13: 46,793,922 V862A probably benign Het
Lct T C 1: 128,300,562 T1065A probably damaging Het
Mark3 G A 12: 111,655,310 A697T probably benign Het
Mosmo A G 7: 120,730,505 I116M possibly damaging Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc15 A T 2: 110,737,472 M321L probably benign Het
Olfr1336 A G 7: 6,460,814 M102V probably benign Het
Olfr376 T A 11: 73,375,264 C172S probably damaging Het
Olfr513 G T 7: 108,755,110 V85L probably benign Het
Ppara T C 15: 85,798,228 I375T possibly damaging Het
Prss27 A G 17: 24,044,903 I188V probably benign Het
Rbms1 A T 2: 60,758,835 M287K possibly damaging Het
Relt C T 7: 100,851,353 probably null Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Sec24a A G 11: 51,708,967 V837A probably benign Het
Smarca2 G A 19: 26,751,905 D19N probably damaging Het
Sorbs2 G A 8: 45,805,777 G620D probably damaging Het
Spata31d1c C A 13: 65,033,224 Q46K probably benign Het
Spata6 C G 4: 111,780,795 S274* probably null Het
Spata6 C T 4: 111,780,797 P275S probably benign Het
Tas2r108 T A 6: 40,493,632 V14D probably benign Het
Thbs2 G T 17: 14,671,288 P996T probably damaging Het
Tmem131l T C 3: 83,931,783 Q620R probably damaging Het
Ubap2l A G 3: 90,034,671 S203P probably damaging Het
Unc45b G A 11: 82,925,945 G404S probably benign Het
Uri1 A G 7: 37,965,386 S292P possibly damaging Het
Usp21 A T 1: 171,283,081 C444S probably damaging Het
Vmn1r117 A T 7: 20,883,559 V188D possibly damaging Het
Vmn1r7 T C 6: 57,025,158 D39G probably damaging Het
Wdr25 T C 12: 108,898,054 F42L possibly damaging Het
Other mutations in Naa25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02025:Naa25 APN 5 121439865 missense probably damaging 1.00
IGL02142:Naa25 APN 5 121426762 missense possibly damaging 0.52
IGL02541:Naa25 APN 5 121424531 missense possibly damaging 0.92
IGL02747:Naa25 APN 5 121414605 splice site probably benign
IGL03074:Naa25 APN 5 121408337 critical splice donor site probably null
IGL03119:Naa25 APN 5 121434978 missense probably null 1.00
IGL03218:Naa25 APN 5 121426070 missense probably damaging 1.00
R0003:Naa25 UTSW 5 121407184 intron probably benign
R0022:Naa25 UTSW 5 121417976 missense probably damaging 1.00
R0022:Naa25 UTSW 5 121417976 missense probably damaging 1.00
R0102:Naa25 UTSW 5 121435569 missense possibly damaging 0.69
R0102:Naa25 UTSW 5 121435569 missense possibly damaging 0.69
R0399:Naa25 UTSW 5 121435490 missense probably benign 0.00
R0973:Naa25 UTSW 5 121438716 splice site probably benign
R1418:Naa25 UTSW 5 121423734 missense probably damaging 1.00
R1793:Naa25 UTSW 5 121417415 missense possibly damaging 0.82
R1793:Naa25 UTSW 5 121420593 missense probably damaging 1.00
R1863:Naa25 UTSW 5 121435548 missense probably benign 0.00
R3160:Naa25 UTSW 5 121435072 splice site probably null
R3162:Naa25 UTSW 5 121435072 splice site probably null
R3721:Naa25 UTSW 5 121431556 missense probably benign
R3864:Naa25 UTSW 5 121409197 missense probably damaging 0.96
R4852:Naa25 UTSW 5 121430692 missense probably damaging 1.00
R5077:Naa25 UTSW 5 121424576 missense probably benign 0.02
R5602:Naa25 UTSW 5 121420495 missense probably benign 0.30
R5855:Naa25 UTSW 5 121423692 missense possibly damaging 0.94
R6464:Naa25 UTSW 5 121417961 missense probably damaging 1.00
R6734:Naa25 UTSW 5 121438825 missense possibly damaging 0.65
R6750:Naa25 UTSW 5 121408309 missense probably damaging 1.00
R6767:Naa25 UTSW 5 121439865 missense probably damaging 1.00
R6856:Naa25 UTSW 5 121438804 missense probably damaging 1.00
R7145:Naa25 UTSW 5 121417489 critical splice donor site probably null
X0004:Naa25 UTSW 5 121413081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGGAATTCAGCCCACACCTTAC -3'
(R):5'- GGACACACCGTTCTCTGACATCTTC -3'

Sequencing Primer
(F):5'- GACTCCTGCGTGTCTGAGTAAC -3'
(R):5'- ACATCTTCTCTGAGTTCTTGGGC -3'
Posted On2014-04-13