Incidental Mutation 'R1582:Olfr513'
ID171473
Institutional Source Beutler Lab
Gene Symbol Olfr513
Ensembl Gene ENSMUSG00000051200
Gene Nameolfactory receptor 513
SynonymsMOR195-1, GA_x6K02T2PBJ9-11084889-11085818
MMRRC Submission 039619-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R1582 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108750973-108756800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108755110 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 85 (V85L)
Ref Sequence ENSEMBL: ENSMUSP00000149440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055146] [ENSMUST00000214670]
Predicted Effect probably benign
Transcript: ENSMUST00000055146
AA Change: V85L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000050578
Gene: ENSMUSG00000051200
AA Change: V85L

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 2.7e-55 PFAM
Pfam:7TM_GPCR_Srsx 33 304 2.3e-6 PFAM
Pfam:7tm_1 39 289 2.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214670
AA Change: V85L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 C G 2: 31,800,359 A630G probably damaging Het
Actr3 A G 1: 125,405,925 Y202H probably benign Het
Adamts19 A G 18: 58,969,941 N685D probably damaging Het
Atl3 A G 19: 7,516,899 T138A probably damaging Het
Bpifa2 T C 2: 154,013,718 S188P probably damaging Het
Bsn T C 9: 108,105,092 T3821A unknown Het
Dcun1d2 A G 8: 13,280,926 L68P probably damaging Het
Ddhd1 A T 14: 45,605,109 L630I probably damaging Het
Ddx25 T C 9: 35,545,976 T348A probably damaging Het
Dtnb C T 12: 3,773,554 T580M possibly damaging Het
Dysf A G 6: 84,097,767 S561G probably damaging Het
Ehbp1l1 A G 19: 5,721,967 I101T possibly damaging Het
Erich3 T C 3: 154,764,323 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam135a T C 1: 24,029,317 T611A probably damaging Het
Gpbp1 T C 13: 111,436,532 probably null Het
H2-Oa A T 17: 34,094,721 T218S probably damaging Het
Kctd19 G A 8: 105,395,460 L152F probably damaging Het
Kdm5b T A 1: 134,624,853 M1189K probably damaging Het
Kif13a A G 13: 46,793,922 V862A probably benign Het
Lct T C 1: 128,300,562 T1065A probably damaging Het
Mark3 G A 12: 111,655,310 A697T probably benign Het
Mosmo A G 7: 120,730,505 I116M possibly damaging Het
Mpped1 C T 15: 83,791,990 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc15 A T 2: 110,737,472 M321L probably benign Het
Naa25 T A 5: 121,434,829 N670K probably benign Het
Olfr1336 A G 7: 6,460,814 M102V probably benign Het
Olfr376 T A 11: 73,375,264 C172S probably damaging Het
Ppara T C 15: 85,798,228 I375T possibly damaging Het
Prss27 A G 17: 24,044,903 I188V probably benign Het
Rbms1 A T 2: 60,758,835 M287K possibly damaging Het
Relt C T 7: 100,851,353 probably null Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Sec24a A G 11: 51,708,967 V837A probably benign Het
Smarca2 G A 19: 26,751,905 D19N probably damaging Het
Sorbs2 G A 8: 45,805,777 G620D probably damaging Het
Spata31d1c C A 13: 65,033,224 Q46K probably benign Het
Spata6 C G 4: 111,780,795 S274* probably null Het
Spata6 C T 4: 111,780,797 P275S probably benign Het
Tas2r108 T A 6: 40,493,632 V14D probably benign Het
Thbs2 G T 17: 14,671,288 P996T probably damaging Het
Tmem131l T C 3: 83,931,783 Q620R probably damaging Het
Ubap2l A G 3: 90,034,671 S203P probably damaging Het
Unc45b G A 11: 82,925,945 G404S probably benign Het
Uri1 A G 7: 37,965,386 S292P possibly damaging Het
Usp21 A T 1: 171,283,081 C444S probably damaging Het
Vmn1r117 A T 7: 20,883,559 V188D possibly damaging Het
Vmn1r7 T C 6: 57,025,158 D39G probably damaging Het
Wdr25 T C 12: 108,898,054 F42L possibly damaging Het
Other mutations in Olfr513
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Olfr513 APN 7 108755114 missense probably damaging 1.00
IGL03086:Olfr513 APN 7 108755796 utr 3 prime probably benign
FR4340:Olfr513 UTSW 7 108754954 small insertion probably benign
IGL02799:Olfr513 UTSW 7 108755623 missense probably benign
R0218:Olfr513 UTSW 7 108755574 nonsense probably null
R1103:Olfr513 UTSW 7 108754883 missense possibly damaging 0.92
R1251:Olfr513 UTSW 7 108754907 missense probably damaging 0.99
R1450:Olfr513 UTSW 7 108755512 missense probably damaging 1.00
R1608:Olfr513 UTSW 7 108755102 missense probably damaging 0.99
R1726:Olfr513 UTSW 7 108755008 missense probably benign 0.00
R1880:Olfr513 UTSW 7 108755128 missense probably damaging 1.00
R1881:Olfr513 UTSW 7 108755128 missense probably damaging 1.00
R2136:Olfr513 UTSW 7 108755223 missense possibly damaging 0.58
R2216:Olfr513 UTSW 7 108755612 missense probably damaging 1.00
R4006:Olfr513 UTSW 7 108755261 missense probably damaging 1.00
R4603:Olfr513 UTSW 7 108755627 missense probably damaging 1.00
R4881:Olfr513 UTSW 7 108755405 missense probably damaging 1.00
R5132:Olfr513 UTSW 7 108755270 missense probably damaging 1.00
R5426:Olfr513 UTSW 7 108755717 missense possibly damaging 0.94
R5679:Olfr513 UTSW 7 108754996 missense probably damaging 0.97
R5848:Olfr513 UTSW 7 108755574 nonsense probably null
R5911:Olfr513 UTSW 7 108755675 missense probably benign 0.36
R6474:Olfr513 UTSW 7 108755029 missense probably damaging 1.00
R7016:Olfr513 UTSW 7 108755711 missense probably damaging 1.00
Z1088:Olfr513 UTSW 7 108755104 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ATGGGATTCACAGATCGCCCTGAG -3'
(R):5'- TGCCGAGAAGATCAGAAGCTGC -3'

Sequencing Primer
(F):5'- ATCGCCCTGAGCTTCAGC -3'
(R):5'- GAAGCCATAGGTGTAGACTCCTATC -3'
Posted On2014-04-13