Incidental Mutation 'R1582:Mpped1'
ID171494
Institutional Source Beutler Lab
Gene Symbol Mpped1
Ensembl Gene ENSMUSG00000041708
Gene Namemetallophosphoesterase domain containing 1
Synonyms
MMRRC Submission 039619-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R1582 (G1)
Quality Score197
Status Not validated
Chromosome15
Chromosomal Location83779467-83858494 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 83791990 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046168] [ENSMUST00000109469] [ENSMUST00000109470] [ENSMUST00000123387] [ENSMUST00000163723] [ENSMUST00000172115] [ENSMUST00000172398]
Predicted Effect probably benign
Transcript: ENSMUST00000046168
SMART Domains Protein: ENSMUSP00000041981
Gene: ENSMUSG00000041708

DomainStartEndE-ValueType
Pfam:Metallophos 90 288 1e-13 PFAM
Pfam:Metallophos_2 91 314 8.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109469
Predicted Effect probably benign
Transcript: ENSMUST00000109470
SMART Domains Protein: ENSMUSP00000105096
Gene: ENSMUSG00000041708

DomainStartEndE-ValueType
Pfam:Metallophos 90 288 1.9e-13 PFAM
Pfam:Metallophos_2 91 318 4.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123387
SMART Domains Protein: ENSMUSP00000123230
Gene: ENSMUSG00000041708

DomainStartEndE-ValueType
PDB:3RL3|A 33 137 2e-54 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000150489
SMART Domains Protein: ENSMUSP00000128786
Gene: ENSMUSG00000041708

DomainStartEndE-ValueType
Pfam:Metallophos 87 217 6.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163723
SMART Domains Protein: ENSMUSP00000126242
Gene: ENSMUSG00000041708

DomainStartEndE-ValueType
Pfam:Metallophos 5 130 3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172115
SMART Domains Protein: ENSMUSP00000132518
Gene: ENSMUSG00000041708

DomainStartEndE-ValueType
PDB:3RL3|A 33 136 1e-52 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000172398
SMART Domains Protein: ENSMUSP00000131333
Gene: ENSMUSG00000041708

DomainStartEndE-ValueType
PDB:3RL3|A 33 140 2e-47 PDB
SCOP:d4kbpa2 84 133 9e-3 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 C G 2: 31,800,359 A630G probably damaging Het
Actr3 A G 1: 125,405,925 Y202H probably benign Het
Adamts19 A G 18: 58,969,941 N685D probably damaging Het
Atl3 A G 19: 7,516,899 T138A probably damaging Het
Bpifa2 T C 2: 154,013,718 S188P probably damaging Het
Bsn T C 9: 108,105,092 T3821A unknown Het
Dcun1d2 A G 8: 13,280,926 L68P probably damaging Het
Ddhd1 A T 14: 45,605,109 L630I probably damaging Het
Ddx25 T C 9: 35,545,976 T348A probably damaging Het
Dtnb C T 12: 3,773,554 T580M possibly damaging Het
Dysf A G 6: 84,097,767 S561G probably damaging Het
Ehbp1l1 A G 19: 5,721,967 I101T possibly damaging Het
Erich3 T C 3: 154,764,323 probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam135a T C 1: 24,029,317 T611A probably damaging Het
Gpbp1 T C 13: 111,436,532 probably null Het
H2-Oa A T 17: 34,094,721 T218S probably damaging Het
Kctd19 G A 8: 105,395,460 L152F probably damaging Het
Kdm5b T A 1: 134,624,853 M1189K probably damaging Het
Kif13a A G 13: 46,793,922 V862A probably benign Het
Lct T C 1: 128,300,562 T1065A probably damaging Het
Mark3 G A 12: 111,655,310 A697T probably benign Het
Mosmo A G 7: 120,730,505 I116M possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc15 A T 2: 110,737,472 M321L probably benign Het
Naa25 T A 5: 121,434,829 N670K probably benign Het
Olfr1336 A G 7: 6,460,814 M102V probably benign Het
Olfr376 T A 11: 73,375,264 C172S probably damaging Het
Olfr513 G T 7: 108,755,110 V85L probably benign Het
Ppara T C 15: 85,798,228 I375T possibly damaging Het
Prss27 A G 17: 24,044,903 I188V probably benign Het
Rbms1 A T 2: 60,758,835 M287K possibly damaging Het
Relt C T 7: 100,851,353 probably null Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Sec24a A G 11: 51,708,967 V837A probably benign Het
Smarca2 G A 19: 26,751,905 D19N probably damaging Het
Sorbs2 G A 8: 45,805,777 G620D probably damaging Het
Spata31d1c C A 13: 65,033,224 Q46K probably benign Het
Spata6 C G 4: 111,780,795 S274* probably null Het
Spata6 C T 4: 111,780,797 P275S probably benign Het
Tas2r108 T A 6: 40,493,632 V14D probably benign Het
Thbs2 G T 17: 14,671,288 P996T probably damaging Het
Tmem131l T C 3: 83,931,783 Q620R probably damaging Het
Ubap2l A G 3: 90,034,671 S203P probably damaging Het
Unc45b G A 11: 82,925,945 G404S probably benign Het
Uri1 A G 7: 37,965,386 S292P possibly damaging Het
Usp21 A T 1: 171,283,081 C444S probably damaging Het
Vmn1r117 A T 7: 20,883,559 V188D possibly damaging Het
Vmn1r7 T C 6: 57,025,158 D39G probably damaging Het
Wdr25 T C 12: 108,898,054 F42L possibly damaging Het
Other mutations in Mpped1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Mpped1 APN 15 83800119 missense probably damaging 1.00
IGL01402:Mpped1 APN 15 83792213 missense possibly damaging 0.94
IGL02004:Mpped1 APN 15 83800156 missense probably damaging 1.00
R0336:Mpped1 UTSW 15 83836282 missense probably damaging 1.00
R1635:Mpped1 UTSW 15 83791990 unclassified probably benign
R1636:Mpped1 UTSW 15 83791990 unclassified probably benign
R1637:Mpped1 UTSW 15 83791990 unclassified probably benign
R1778:Mpped1 UTSW 15 83791990 unclassified probably benign
R3787:Mpped1 UTSW 15 83796583 intron probably benign
R4114:Mpped1 UTSW 15 83796709 intron probably benign
R4116:Mpped1 UTSW 15 83796709 intron probably benign
R4977:Mpped1 UTSW 15 83796706 intron probably benign
R4982:Mpped1 UTSW 15 83836327 missense probably damaging 1.00
R6352:Mpped1 UTSW 15 83836363 missense probably damaging 1.00
R6765:Mpped1 UTSW 15 83836383 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTTGGACCATGCACGCATC -3'
(R):5'- GGGATTGGAGCTGTATTCGTCCAC -3'

Sequencing Primer
(F):5'- TTCATCAAACTGCTGAGATGGAAAG -3'
(R):5'- GTCCACCTCGATGATGAGTC -3'
Posted On2014-04-13