Incidental Mutation 'R1539:Vwa8'
ID171601
Institutional Source Beutler Lab
Gene Symbol Vwa8
Ensembl Gene ENSMUSG00000058997
Gene Namevon Willebrand factor A domain containing 8
Synonyms4932416F07Rik, 1300010F03Rik
MMRRC Submission 039578-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R1539 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location78849052-79202310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79062562 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 945 (D945G)
Ref Sequence ENSEMBL: ENSMUSP00000154270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040990] [ENSMUST00000227255]
Predicted Effect probably benign
Transcript: ENSMUST00000040990
AA Change: D945G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000048925
Gene: ENSMUSG00000058997
AA Change: D945G

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 20 33 N/A INTRINSIC
Pfam:AAA_5 104 260 6.3e-44 PFAM
AAA 438 613 4.69e-2 SMART
AAA 772 904 1.26e-1 SMART
low complexity region 1213 1221 N/A INTRINSIC
low complexity region 1565 1586 N/A INTRINSIC
VWA 1712 1901 2.71e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227255
AA Change: D945G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik T A 17: 23,717,144 probably benign Het
Adgrv1 T A 13: 81,503,978 probably null Het
Adh7 A C 3: 138,223,955 T131P possibly damaging Het
Agxt G A 1: 93,137,979 G190D probably damaging Het
AI182371 A G 2: 35,088,803 I193T probably damaging Het
Akna T A 4: 63,379,310 T836S probably benign Het
Alox12 T C 11: 70,253,243 probably null Het
Anapc2 C A 2: 25,273,063 T104K probably benign Het
Ank1 T C 8: 23,093,919 L346P probably damaging Het
Ankfn1 A T 11: 89,441,391 I443N probably damaging Het
Arhgef17 G A 7: 100,890,473 T1066I probably damaging Het
Atg2a C A 19: 6,246,771 probably null Het
Atp5s G A 12: 69,741,071 D94N probably benign Het
Bpifb5 T A 2: 154,223,856 H24Q probably benign Het
Brd9 A G 13: 73,944,743 E283G probably damaging Het
Cadm2 C A 16: 66,784,840 V184F probably damaging Het
Casr A G 16: 36,495,137 V857A probably benign Het
Ccdc18 A T 5: 108,191,977 Q796L probably damaging Het
Cep290 T C 10: 100,496,828 V263A probably benign Het
Clec10a A T 11: 70,169,819 N167Y probably damaging Het
Cog1 A G 11: 113,652,232 I189V possibly damaging Het
Commd2 A G 3: 57,646,848 I144T probably benign Het
Cse1l A G 2: 166,926,372 T197A probably benign Het
Csmd3 A T 15: 47,820,398 S1783R probably benign Het
Cxxc1 T C 18: 74,219,207 V334A possibly damaging Het
Dennd2d A G 3: 106,486,920 I39V probably benign Het
Dgkz G A 2: 91,938,060 P734S probably damaging Het
Diaph3 T C 14: 86,656,480 D31G probably damaging Het
Dlec1 T C 9: 119,127,450 S731P probably benign Het
Dnah11 T C 12: 117,931,256 R3619G probably benign Het
Doc2b A G 11: 75,771,957 L405P probably damaging Het
Dock3 A T 9: 106,952,364 I1117N probably damaging Het
Dock3 G A 9: 106,996,913 A453V probably benign Het
Ece2 T A 16: 20,642,513 I474N probably damaging Het
Etv4 A T 11: 101,771,687 probably null Het
Fam171b A T 2: 83,880,098 M705L probably benign Het
Frem2 T C 3: 53,654,210 K959E probably benign Het
Fyn T C 10: 39,532,070 M251T possibly damaging Het
Galnt13 G A 2: 54,857,857 G250E probably damaging Het
Ggh T C 4: 20,054,204 probably null Het
Glcci1 A G 6: 8,591,620 E222G probably damaging Het
Gm1968 G A 16: 29,958,841 noncoding transcript Het
Gm3604 T A 13: 62,371,600 I52F possibly damaging Het
Gm43302 T C 5: 105,274,769 I466V probably benign Het
Gm9789 T C 16: 89,158,146 S48P unknown Het
Gpat3 A T 5: 100,883,388 Y136F probably benign Het
Gpr171 T C 3: 59,097,721 D211G possibly damaging Het
Hs3st1 T C 5: 39,614,448 K284R probably benign Het
Htr2a C T 14: 74,645,168 A198V possibly damaging Het
Ice1 C A 13: 70,605,904 D688Y probably damaging Het
Jade1 T C 3: 41,604,996 M504T probably benign Het
Lrp1 T C 10: 127,584,381 probably null Het
Lsr A T 7: 30,972,092 I72N possibly damaging Het
Magel2 G A 7: 62,378,809 R487H possibly damaging Het
Mertk A G 2: 128,782,526 D619G probably benign Het
Myo1b A T 1: 51,799,563 V245E probably damaging Het
Myrip T A 9: 120,424,623 L254Q probably benign Het
Nav3 A G 10: 109,767,170 S1173P probably damaging Het
Ncoa7 T C 10: 30,771,729 Y17C probably damaging Het
Ncor2 T C 5: 125,109,939 E7G probably benign Het
Ninl A G 2: 150,975,947 V99A probably damaging Het
Noct G T 3: 51,247,912 E34* probably null Het
Notch1 A T 2: 26,472,113 Y1043* probably null Het
Olfr1420 T C 19: 11,896,491 S157P possibly damaging Het
Olfr532 T A 7: 140,419,413 Y120F probably benign Het
Olfr707 A G 7: 106,891,276 Y278H probably damaging Het
Olfr794 G A 10: 129,570,771 G39R probably damaging Het
Pde7b C A 10: 20,479,686 R104L possibly damaging Het
Pkn1 C A 8: 83,670,337 R890L possibly damaging Het
Podn A T 4: 108,021,567 Y368N probably damaging Het
Polr1b G A 2: 129,118,099 probably null Het
Ppp1r3c A T 19: 36,733,961 F136L probably benign Het
Ppp2ca T A 11: 52,120,973 F260Y probably damaging Het
Prss39 A G 1: 34,498,535 S27G possibly damaging Het
Ptch1 A G 13: 63,541,287 V340A probably benign Het
Ranbp17 T C 11: 33,297,394 I246V probably damaging Het
Rilpl1 T A 5: 124,515,555 D181V probably damaging Het
Sdk1 T A 5: 142,094,599 V1282D probably damaging Het
Sh3rf2 T C 18: 42,149,822 S514P probably damaging Het
Slc35f2 A T 9: 53,809,708 I252F possibly damaging Het
Slc7a1 A G 5: 148,335,593 Y425H possibly damaging Het
Spaca4 G T 7: 45,725,560 probably benign Het
Spata31d1b T C 13: 59,715,919 S294P possibly damaging Het
Ssh1 T G 5: 113,952,003 T342P probably damaging Het
Stk10 T A 11: 32,533,440 S13T possibly damaging Het
Tbx1 G T 16: 18,584,093 D214E probably benign Het
Tdp1 A G 12: 99,912,312 E453G probably damaging Het
Tlr1 T C 5: 64,926,976 Y86C probably damaging Het
Tmem241 A T 18: 12,043,240 C124S possibly damaging Het
Trp63 A G 16: 25,884,849 M516V probably benign Het
Ttc28 T C 5: 111,100,811 V210A possibly damaging Het
Tut1 C T 19: 8,965,486 R646W probably benign Het
Ubald1 C T 16: 4,876,397 E49K possibly damaging Het
Usp28 T C 9: 49,037,796 Y897H probably benign Het
Vmn2r27 A C 6: 124,191,771 F800C probably damaging Het
Vmn2r83 T A 10: 79,491,925 M789K probably damaging Het
Wdhd1 T A 14: 47,245,050 K947N possibly damaging Het
Wdr12 A T 1: 60,083,848 probably null Het
Xrra1 A T 7: 99,871,357 E57V probably damaging Het
Other mutations in Vwa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Vwa8 APN 14 79038195 missense probably damaging 1.00
IGL01087:Vwa8 APN 14 78935229 missense probably benign 0.16
IGL01137:Vwa8 APN 14 79103647 missense probably damaging 1.00
IGL01359:Vwa8 APN 14 79064913 nonsense probably null
IGL01449:Vwa8 APN 14 79182988 nonsense probably null
IGL01604:Vwa8 APN 14 79180804 missense possibly damaging 0.82
IGL01636:Vwa8 APN 14 79198354 missense possibly damaging 0.68
IGL01815:Vwa8 APN 14 79198277 missense possibly damaging 0.92
IGL02024:Vwa8 APN 14 79094284 missense possibly damaging 0.91
IGL02033:Vwa8 APN 14 78984209 missense possibly damaging 0.89
IGL02154:Vwa8 APN 14 78849293 missense possibly damaging 0.53
IGL02286:Vwa8 APN 14 78947273 critical splice donor site probably null
IGL02393:Vwa8 APN 14 79182977 missense probably damaging 1.00
IGL02430:Vwa8 APN 14 78934645 critical splice donor site probably null
IGL02476:Vwa8 APN 14 78925341 missense possibly damaging 0.62
IGL02612:Vwa8 APN 14 79183112 missense probably benign 0.01
IGL02678:Vwa8 APN 14 78984200 missense probably damaging 0.99
IGL02797:Vwa8 APN 14 78925262 missense probably benign 0.29
IGL02806:Vwa8 APN 14 79157088 missense probably benign 0.35
IGL02811:Vwa8 APN 14 78994459 missense probably benign 0.21
IGL02892:Vwa8 APN 14 79103700 splice site probably benign
IGL03024:Vwa8 APN 14 78995098 missense probably benign 0.03
IGL03075:Vwa8 APN 14 78933756 missense probably damaging 0.99
IGL03090:Vwa8 APN 14 78934601 missense possibly damaging 0.92
IGL03124:Vwa8 APN 14 79058815 splice site probably benign
IGL03181:Vwa8 APN 14 79009250 missense probably benign 0.01
IGL03296:Vwa8 APN 14 79183100 missense probably damaging 0.98
IGL03376:Vwa8 APN 14 79183134 splice site probably null
IGL03052:Vwa8 UTSW 14 79064921 missense probably benign 0.02
PIT4468001:Vwa8 UTSW 14 79183061 missense probably damaging 1.00
R0049:Vwa8 UTSW 14 79093739 missense probably benign 0.21
R0063:Vwa8 UTSW 14 79164216 splice site probably benign
R0063:Vwa8 UTSW 14 79164216 splice site probably benign
R0081:Vwa8 UTSW 14 79082782 missense probably benign 0.02
R0305:Vwa8 UTSW 14 79009273 missense probably damaging 1.00
R0433:Vwa8 UTSW 14 79062676 missense probably damaging 1.00
R0514:Vwa8 UTSW 14 78947189 missense probably benign
R0602:Vwa8 UTSW 14 79020620 missense probably benign 0.00
R0615:Vwa8 UTSW 14 78908150 missense probably benign
R0791:Vwa8 UTSW 14 78994576 splice site probably benign
R1028:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1037:Vwa8 UTSW 14 79086654 nonsense probably null
R1404:Vwa8 UTSW 14 79026031 missense probably damaging 1.00
R1404:Vwa8 UTSW 14 79026031 missense probably damaging 1.00
R1412:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1421:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1467:Vwa8 UTSW 14 79103694 nonsense probably null
R1467:Vwa8 UTSW 14 79103694 nonsense probably null
R1556:Vwa8 UTSW 14 79086681 missense probably benign
R1589:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1590:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1591:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1645:Vwa8 UTSW 14 79182987 missense probably damaging 1.00
R1673:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1688:Vwa8 UTSW 14 79201103 missense possibly damaging 0.72
R1764:Vwa8 UTSW 14 78908195 missense probably damaging 1.00
R1830:Vwa8 UTSW 14 79081136 missense probably benign 0.04
R1926:Vwa8 UTSW 14 79020635 missense probably benign 0.00
R1959:Vwa8 UTSW 14 78982360 missense possibly damaging 0.95
R1971:Vwa8 UTSW 14 78925254 splice site probably benign
R2078:Vwa8 UTSW 14 78908157 missense probably damaging 1.00
R2103:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R2230:Vwa8 UTSW 14 79092403 critical splice donor site probably null
R2281:Vwa8 UTSW 14 79064996 missense possibly damaging 0.91
R2313:Vwa8 UTSW 14 78912218 missense probably damaging 0.98
R2847:Vwa8 UTSW 14 78947142 missense probably benign 0.00
R2848:Vwa8 UTSW 14 78947142 missense probably benign 0.00
R2894:Vwa8 UTSW 14 79038138 missense probably damaging 1.00
R2991:Vwa8 UTSW 14 78995149 missense probably benign 0.00
R3077:Vwa8 UTSW 14 79098342 missense probably benign 0.03
R3405:Vwa8 UTSW 14 79164220 splice site probably benign
R3406:Vwa8 UTSW 14 79164220 splice site probably benign
R3708:Vwa8 UTSW 14 79062696 splice site probably benign
R3779:Vwa8 UTSW 14 79102322 splice site probably benign
R3799:Vwa8 UTSW 14 79064896 missense probably damaging 0.99
R4230:Vwa8 UTSW 14 79082852 missense probably benign 0.00
R4425:Vwa8 UTSW 14 79082806 missense probably benign 0.00
R4478:Vwa8 UTSW 14 78868801 missense probably benign 0.00
R4627:Vwa8 UTSW 14 79103697 critical splice donor site probably null
R4835:Vwa8 UTSW 14 78934613 missense probably benign 0.11
R4868:Vwa8 UTSW 14 79183082 missense probably damaging 1.00
R4988:Vwa8 UTSW 14 79198283 missense probably benign 0.05
R5137:Vwa8 UTSW 14 79064902 missense probably damaging 1.00
R5156:Vwa8 UTSW 14 78984226 missense probably benign 0.00
R5658:Vwa8 UTSW 14 78982398 critical splice donor site probably null
R5841:Vwa8 UTSW 14 78994518 missense probably benign
R6057:Vwa8 UTSW 14 79082873 missense probably benign 0.21
R6244:Vwa8 UTSW 14 79086662 missense probably benign
R6264:Vwa8 UTSW 14 79086812 missense possibly damaging 0.64
R6290:Vwa8 UTSW 14 79094332 splice site probably null
R6332:Vwa8 UTSW 14 79197464 missense probably benign
R6395:Vwa8 UTSW 14 79093744 missense probably benign 0.02
R6472:Vwa8 UTSW 14 79009170 missense possibly damaging 0.71
R6497:Vwa8 UTSW 14 79096401 missense probably benign 0.00
R6527:Vwa8 UTSW 14 78947213 missense possibly damaging 0.73
R6552:Vwa8 UTSW 14 79198222 missense possibly damaging 0.80
R6812:Vwa8 UTSW 14 79197419 missense probably damaging 0.99
R6994:Vwa8 UTSW 14 78908156 missense possibly damaging 0.90
R7040:Vwa8 UTSW 14 78912205 missense probably damaging 1.00
Z1088:Vwa8 UTSW 14 78982246 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TCCCACTGAGTGTTTTGCCAGG -3'
(R):5'- TGCACACATCACATCAGGTTGCC -3'

Sequencing Primer
(F):5'- TCTCCCAGTAAGCATGTATTCAGAC -3'
(R):5'- CCTGGCTGATCTGTCATAGAACG -3'
Posted On2014-04-13