Incidental Mutation 'R1539:Tut1'
ID171620
Institutional Source Beutler Lab
Gene Symbol Tut1
Ensembl Gene ENSMUSG00000071645
Gene Nameterminal uridylyl transferase 1, U6 snRNA-specific
SynonymsPAPD2, Rbm21, 2700038E08Rik, TUTase6
MMRRC Submission 039578-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #R1539 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8953850-8966207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8965486 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 646 (R646W)
Ref Sequence ENSEMBL: ENSMUSP00000093958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052248] [ENSMUST00000096239]
Predicted Effect probably benign
Transcript: ENSMUST00000052248
SMART Domains Protein: ENSMUSP00000093955
Gene: ENSMUSG00000071644

DomainStartEndE-ValueType
Pfam:GST_N 2 81 1.5e-25 PFAM
Pfam:GST_N_3 6 83 1.4e-8 PFAM
Pfam:GST_C_3 88 194 8.3e-13 PFAM
Pfam:GST_C 106 198 4.5e-22 PFAM
Pfam:GST_C_2 125 191 8.6e-12 PFAM
low complexity region 238 262 N/A INTRINSIC
EF1G 275 381 3.63e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096239
AA Change: R646W

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000093958
Gene: ENSMUSG00000071645
AA Change: R646W

DomainStartEndE-ValueType
ZnF_C2H2 16 40 1.53e-1 SMART
RRM 57 124 2.02e-10 SMART
SCOP:d1f5aa2 173 221 1e-3 SMART
low complexity region 242 258 N/A INTRINSIC
low complexity region 300 314 N/A INTRINSIC
low complexity region 324 347 N/A INTRINSIC
low complexity region 423 434 N/A INTRINSIC
Pfam:PAP_assoc 493 552 2.7e-8 PFAM
low complexity region 594 618 N/A INTRINSIC
low complexity region 767 782 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152076
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleotidyl transferase that functions as both a terminal uridylyltransferase and a nuclear poly(A) polymerase. The encoded enzyme specifically adds and removes nucleotides from the 3' end of small nuclear RNAs and select mRNAs and may function in controlling gene expression and cell proliferation.[provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik T A 17: 23,717,144 probably benign Het
Adgrv1 T A 13: 81,503,978 probably null Het
Adh7 A C 3: 138,223,955 T131P possibly damaging Het
Agxt G A 1: 93,137,979 G190D probably damaging Het
AI182371 A G 2: 35,088,803 I193T probably damaging Het
Akna T A 4: 63,379,310 T836S probably benign Het
Alox12 T C 11: 70,253,243 probably null Het
Anapc2 C A 2: 25,273,063 T104K probably benign Het
Ank1 T C 8: 23,093,919 L346P probably damaging Het
Ankfn1 A T 11: 89,441,391 I443N probably damaging Het
Arhgef17 G A 7: 100,890,473 T1066I probably damaging Het
Atg2a C A 19: 6,246,771 probably null Het
Atp5s G A 12: 69,741,071 D94N probably benign Het
Bpifb5 T A 2: 154,223,856 H24Q probably benign Het
Brd9 A G 13: 73,944,743 E283G probably damaging Het
Cadm2 C A 16: 66,784,840 V184F probably damaging Het
Casr A G 16: 36,495,137 V857A probably benign Het
Ccdc18 A T 5: 108,191,977 Q796L probably damaging Het
Cep290 T C 10: 100,496,828 V263A probably benign Het
Clec10a A T 11: 70,169,819 N167Y probably damaging Het
Cog1 A G 11: 113,652,232 I189V possibly damaging Het
Commd2 A G 3: 57,646,848 I144T probably benign Het
Cse1l A G 2: 166,926,372 T197A probably benign Het
Csmd3 A T 15: 47,820,398 S1783R probably benign Het
Cxxc1 T C 18: 74,219,207 V334A possibly damaging Het
Dennd2d A G 3: 106,486,920 I39V probably benign Het
Dgkz G A 2: 91,938,060 P734S probably damaging Het
Diaph3 T C 14: 86,656,480 D31G probably damaging Het
Dlec1 T C 9: 119,127,450 S731P probably benign Het
Dnah11 T C 12: 117,931,256 R3619G probably benign Het
Doc2b A G 11: 75,771,957 L405P probably damaging Het
Dock3 A T 9: 106,952,364 I1117N probably damaging Het
Dock3 G A 9: 106,996,913 A453V probably benign Het
Ece2 T A 16: 20,642,513 I474N probably damaging Het
Etv4 A T 11: 101,771,687 probably null Het
Fam171b A T 2: 83,880,098 M705L probably benign Het
Frem2 T C 3: 53,654,210 K959E probably benign Het
Fyn T C 10: 39,532,070 M251T possibly damaging Het
Galnt13 G A 2: 54,857,857 G250E probably damaging Het
Ggh T C 4: 20,054,204 probably null Het
Glcci1 A G 6: 8,591,620 E222G probably damaging Het
Gm1968 G A 16: 29,958,841 noncoding transcript Het
Gm3604 T A 13: 62,371,600 I52F possibly damaging Het
Gm43302 T C 5: 105,274,769 I466V probably benign Het
Gm9789 T C 16: 89,158,146 S48P unknown Het
Gpat3 A T 5: 100,883,388 Y136F probably benign Het
Gpr171 T C 3: 59,097,721 D211G possibly damaging Het
Hs3st1 T C 5: 39,614,448 K284R probably benign Het
Htr2a C T 14: 74,645,168 A198V possibly damaging Het
Ice1 C A 13: 70,605,904 D688Y probably damaging Het
Jade1 T C 3: 41,604,996 M504T probably benign Het
Lrp1 T C 10: 127,584,381 probably null Het
Lsr A T 7: 30,972,092 I72N possibly damaging Het
Magel2 G A 7: 62,378,809 R487H possibly damaging Het
Mertk A G 2: 128,782,526 D619G probably benign Het
Myo1b A T 1: 51,799,563 V245E probably damaging Het
Myrip T A 9: 120,424,623 L254Q probably benign Het
Nav3 A G 10: 109,767,170 S1173P probably damaging Het
Ncoa7 T C 10: 30,771,729 Y17C probably damaging Het
Ncor2 T C 5: 125,109,939 E7G probably benign Het
Ninl A G 2: 150,975,947 V99A probably damaging Het
Noct G T 3: 51,247,912 E34* probably null Het
Notch1 A T 2: 26,472,113 Y1043* probably null Het
Olfr1420 T C 19: 11,896,491 S157P possibly damaging Het
Olfr532 T A 7: 140,419,413 Y120F probably benign Het
Olfr707 A G 7: 106,891,276 Y278H probably damaging Het
Olfr794 G A 10: 129,570,771 G39R probably damaging Het
Pde7b C A 10: 20,479,686 R104L possibly damaging Het
Pkn1 C A 8: 83,670,337 R890L possibly damaging Het
Podn A T 4: 108,021,567 Y368N probably damaging Het
Polr1b G A 2: 129,118,099 probably null Het
Ppp1r3c A T 19: 36,733,961 F136L probably benign Het
Ppp2ca T A 11: 52,120,973 F260Y probably damaging Het
Prss39 A G 1: 34,498,535 S27G possibly damaging Het
Ptch1 A G 13: 63,541,287 V340A probably benign Het
Ranbp17 T C 11: 33,297,394 I246V probably damaging Het
Rilpl1 T A 5: 124,515,555 D181V probably damaging Het
Sdk1 T A 5: 142,094,599 V1282D probably damaging Het
Sh3rf2 T C 18: 42,149,822 S514P probably damaging Het
Slc35f2 A T 9: 53,809,708 I252F possibly damaging Het
Slc7a1 A G 5: 148,335,593 Y425H possibly damaging Het
Spaca4 G T 7: 45,725,560 probably benign Het
Spata31d1b T C 13: 59,715,919 S294P possibly damaging Het
Ssh1 T G 5: 113,952,003 T342P probably damaging Het
Stk10 T A 11: 32,533,440 S13T possibly damaging Het
Tbx1 G T 16: 18,584,093 D214E probably benign Het
Tdp1 A G 12: 99,912,312 E453G probably damaging Het
Tlr1 T C 5: 64,926,976 Y86C probably damaging Het
Tmem241 A T 18: 12,043,240 C124S possibly damaging Het
Trp63 A G 16: 25,884,849 M516V probably benign Het
Ttc28 T C 5: 111,100,811 V210A possibly damaging Het
Ubald1 C T 16: 4,876,397 E49K possibly damaging Het
Usp28 T C 9: 49,037,796 Y897H probably benign Het
Vmn2r27 A C 6: 124,191,771 F800C probably damaging Het
Vmn2r83 T A 10: 79,491,925 M789K probably damaging Het
Vwa8 A G 14: 79,062,562 D945G probably benign Het
Wdhd1 T A 14: 47,245,050 K947N possibly damaging Het
Wdr12 A T 1: 60,083,848 probably null Het
Xrra1 A T 7: 99,871,357 E57V probably damaging Het
Other mutations in Tut1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Tut1 APN 19 8959096 missense probably damaging 1.00
IGL01934:Tut1 APN 19 8953991 missense probably damaging 1.00
IGL01980:Tut1 APN 19 8954000 missense probably damaging 1.00
IGL02115:Tut1 APN 19 8965312 missense probably damaging 1.00
IGL02375:Tut1 APN 19 8964039 missense probably damaging 1.00
IGL02683:Tut1 APN 19 8965258 missense probably benign 0.31
IGL02899:Tut1 APN 19 8962387 missense probably damaging 1.00
IGL02953:Tut1 APN 19 8962692 missense probably damaging 1.00
PIT4280001:Tut1 UTSW 19 8959262 missense probably benign 0.00
R0014:Tut1 UTSW 19 8962447 missense possibly damaging 0.61
R0014:Tut1 UTSW 19 8962447 missense possibly damaging 0.61
R0033:Tut1 UTSW 19 8962759 missense probably benign 0.03
R0091:Tut1 UTSW 19 8965436 missense probably damaging 0.97
R0173:Tut1 UTSW 19 8965483 nonsense probably null
R0362:Tut1 UTSW 19 8955527 missense possibly damaging 0.94
R0371:Tut1 UTSW 19 8962773 missense probably damaging 0.98
R0386:Tut1 UTSW 19 8955555 missense probably benign 0.00
R1022:Tut1 UTSW 19 8959355 missense probably benign
R1024:Tut1 UTSW 19 8959355 missense probably benign
R1921:Tut1 UTSW 19 8966102 missense probably benign
R1958:Tut1 UTSW 19 8959313 missense probably damaging 1.00
R2508:Tut1 UTSW 19 8955567 missense probably damaging 0.98
R4757:Tut1 UTSW 19 8959308 missense possibly damaging 0.83
R5104:Tut1 UTSW 19 8959334 missense probably benign 0.03
R5185:Tut1 UTSW 19 8955450 missense probably benign 0.07
R6999:Tut1 UTSW 19 8966018 missense probably damaging 1.00
R7084:Tut1 UTSW 19 8965414 missense probably benign
R7091:Tut1 UTSW 19 8965811 missense probably benign
R7313:Tut1 UTSW 19 8964049 missense probably benign 0.00
R7361:Tut1 UTSW 19 8965334 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTACTGCCGAAGTCTCCAGTACC -3'
(R):5'- TTGCAGTCATCAGGGGCAACTC -3'

Sequencing Primer
(F):5'- TCCAGTACCAGCAGCGTTC -3'
(R):5'- TGGTCCCGAGTGCAACAAG -3'
Posted On2014-04-13