Incidental Mutation 'R1540:Casz1'
ID171649
Institutional Source Beutler Lab
Gene Symbol Casz1
Ensembl Gene ENSMUSG00000028977
Gene Namecastor zinc finger 1
SynonymsD4Ertd432e, 2410019P08Rik, Cst, castor
MMRRC Submission 039579-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1540 (G1)
Quality Score221
Status Validated
Chromosome4
Chromosomal Location148804429-148954889 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 148942900 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094464] [ENSMUST00000122222] [ENSMUST00000139806]
Predicted Effect probably benign
Transcript: ENSMUST00000094464
SMART Domains Protein: ENSMUSP00000092035
Gene: ENSMUSG00000028977

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122222
SMART Domains Protein: ENSMUSP00000112978
Gene: ENSMUSG00000028977

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
ZnF_C2H2 1182 1206 1.59e1 SMART
ZnF_C2H2 1242 1266 2.47e1 SMART
ZnF_C2H2 1300 1324 3.47e0 SMART
ZnF_C2H2 1457 1481 7.89e0 SMART
ZnF_C2H2 1515 1537 3.21e1 SMART
ZnF_C2H2 1571 1595 3.99e0 SMART
low complexity region 1632 1649 N/A INTRINSIC
SCOP:d1qbkb_ 1675 1742 2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123548
Predicted Effect probably benign
Transcript: ENSMUST00000139806
SMART Domains Protein: ENSMUSP00000120307
Gene: ENSMUSG00000028977

DomainStartEndE-ValueType
low complexity region 117 134 N/A INTRINSIC
ZnF_C2H2 203 228 5.34e0 SMART
ZnF_C2H2 264 288 8.09e-1 SMART
ZnF_C2H2 323 347 9.3e-1 SMART
low complexity region 357 372 N/A INTRINSIC
ZnF_C2H2 381 405 1.1e-2 SMART
low complexity region 412 425 N/A INTRINSIC
low complexity region 442 480 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 524 548 N/A INTRINSIC
low complexity region 589 604 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality throughout fetal growth and development and abnormal heart development associated with edema, decreased fetal cardiomyocyte proliferation, myocardium hypoplasia, ventricular septal defect, and altered heart shape and Z line formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A G 3: 116,780,735 C767R probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ap3d1 A T 10: 80,715,941 I644N probably benign Het
Asb16 A G 11: 102,272,576 I131V probably benign Het
Atp6v0a2 C A 5: 124,646,698 A307D probably damaging Het
C1qtnf1 C T 11: 118,447,923 H140Y probably benign Het
Cacna1g T A 11: 94,457,039 D741V probably damaging Het
Caprin2 T A 6: 148,876,471 T211S probably benign Het
Carmil1 T C 13: 24,099,054 E89G possibly damaging Het
Catsperb G A 12: 101,412,330 R30Q probably benign Het
Ccdc102a A T 8: 94,907,713 probably null Het
Ccdc110 G T 8: 45,942,325 E418* probably null Het
Ccdc90b C T 7: 92,581,816 A210V probably benign Het
Cdadc1 G T 14: 59,586,083 A320E probably damaging Het
Cdadc1 T A 14: 59,586,092 Q317L probably damaging Het
Cep170 C A 1: 176,739,932 W1396L probably damaging Het
Col4a6 T C X: 141,227,858 T129A probably damaging Het
Ctcfl C T 2: 173,112,348 D319N probably benign Het
Dclk1 T C 3: 55,477,823 S45P probably damaging Het
Efcab3 T C 11: 105,108,900 I5581T probably benign Het
Evi2 T C 11: 79,515,586 I388V probably benign Het
Fbxl5 A T 5: 43,758,636 V435E possibly damaging Het
Fig4 A T 10: 41,188,586 M887K possibly damaging Het
Glt8d1 G A 14: 31,011,592 V345I probably benign Het
Gm5709 T C 3: 59,618,652 noncoding transcript Het
Hsp90b1 A G 10: 86,694,042 F264L probably damaging Het
Id3 A G 4: 136,143,939 S21G possibly damaging Het
Ighe T A 12: 113,271,446 N365Y unknown Het
Il17rd T G 14: 27,099,958 M403R probably damaging Het
Ints10 A G 8: 68,796,713 probably benign Het
Kcnc4 T A 3: 107,445,427 probably null Het
Kctd19 A G 8: 105,387,879 S517P probably damaging Het
Lama5 A G 2: 180,180,151 F2964L probably benign Het
Lin54 A T 5: 100,480,250 N31K probably damaging Het
Lrrc8e A G 8: 4,234,990 K405R probably benign Het
Lyst T A 13: 13,635,101 M452K possibly damaging Het
Mroh7 A G 4: 106,703,076 L677P probably benign Het
Mrps27 T A 13: 99,405,050 F221I probably benign Het
Nhlrc1 C T 13: 47,014,344 V146M probably damaging Het
Nlrp9b T A 7: 20,048,847 C895* probably null Het
Nod1 T C 6: 54,943,975 T453A probably benign Het
Nodal T C 10: 61,422,985 V67A probably damaging Het
Ntsr1 T C 2: 180,542,647 L381P probably damaging Het
Olfr1360 T A 13: 21,674,530 Q138L probably benign Het
Olfr272 T C 4: 52,910,996 D266G probably benign Het
Olfr311 T A 11: 58,841,651 M179K probably benign Het
P2ry14 T A 3: 59,115,265 K267M probably benign Het
Pcdh1 T C 18: 38,189,726 N1018S probably benign Het
Pkn3 G A 2: 30,084,691 V406I probably damaging Het
Prkcb C T 7: 122,627,693 T634I probably damaging Het
Psme2b T A 11: 48,945,382 probably null Het
Ptgfrn A G 3: 101,060,654 I541T probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgapb T C 2: 158,465,826 V684A probably benign Het
Rbbp5 C T 1: 132,494,282 R307* probably null Het
Rcor1 T A 12: 111,103,603 probably benign Het
Rlbp1 C T 7: 79,380,060 A142T probably damaging Het
Rps6ka2 A G 17: 7,292,906 E581G probably null Het
Sars A T 3: 108,433,145 V155E probably benign Het
Sec31a G C 5: 100,375,319 P569A probably damaging Het
Selenof A T 3: 144,594,924 K111* probably null Het
Serpinb7 C T 1: 107,428,268 A7V possibly damaging Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Snrpa1 T A 7: 66,070,661 I204N probably damaging Het
Spry4 T G 18: 38,601,687 probably benign Het
Tcea2 A G 2: 181,686,958 N261S possibly damaging Het
Tmem59l A G 8: 70,485,154 F192S probably benign Het
Tnr T A 1: 159,850,105 I20N probably damaging Het
Ttll5 C T 12: 85,892,208 Q427* probably null Het
Vps45 C T 3: 96,048,346 A111T probably damaging Het
Zfp395 T C 14: 65,393,074 S358P probably benign Het
Zfp438 A G 18: 5,210,740 V766A probably benign Het
Other mutations in Casz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Casz1 APN 4 148929371 missense probably damaging 1.00
IGL02137:Casz1 APN 4 148933468 missense possibly damaging 0.71
IGL02176:Casz1 APN 4 148934619 missense probably damaging 1.00
IGL02629:Casz1 APN 4 148944391 missense probably benign 0.01
IGL02871:Casz1 APN 4 148944319 missense possibly damaging 0.93
FR4340:Casz1 UTSW 4 148952302 small deletion probably benign
H8562:Casz1 UTSW 4 148933451 missense probably damaging 1.00
R0090:Casz1 UTSW 4 148933411 missense probably benign 0.00
R0389:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0443:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0550:Casz1 UTSW 4 148952284 small deletion probably benign
R0597:Casz1 UTSW 4 148944394 missense probably benign 0.00
R1117:Casz1 UTSW 4 148934595 missense probably damaging 1.00
R1476:Casz1 UTSW 4 148946171 missense probably benign 0.05
R1610:Casz1 UTSW 4 148929087 missense possibly damaging 0.54
R1764:Casz1 UTSW 4 148942900 unclassified probably benign
R1779:Casz1 UTSW 4 148932937 missense probably benign 0.00
R1874:Casz1 UTSW 4 148943211 missense probably damaging 0.99
R1902:Casz1 UTSW 4 148936195 missense possibly damaging 0.95
R1914:Casz1 UTSW 4 148932958 missense probably damaging 1.00
R2126:Casz1 UTSW 4 148946064 missense probably damaging 0.99
R2261:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R2262:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R3874:Casz1 UTSW 4 148939589 intron probably benign
R4019:Casz1 UTSW 4 148932878 missense probably benign 0.00
R4355:Casz1 UTSW 4 148952335 missense unknown
R4420:Casz1 UTSW 4 148948918 missense possibly damaging 0.90
R4610:Casz1 UTSW 4 148933267 missense probably damaging 1.00
R4632:Casz1 UTSW 4 148951855 missense possibly damaging 0.71
R4762:Casz1 UTSW 4 148938981 missense probably damaging 1.00
R4824:Casz1 UTSW 4 148944571 missense probably damaging 1.00
R4907:Casz1 UTSW 4 148944541 missense probably damaging 1.00
R5628:Casz1 UTSW 4 148946096 missense probably damaging 1.00
R5736:Casz1 UTSW 4 148929410 missense probably benign 0.00
R5929:Casz1 UTSW 4 148938696 missense probably damaging 1.00
R5929:Casz1 UTSW 4 148938969 missense probably damaging 1.00
R5932:Casz1 UTSW 4 148939113 missense possibly damaging 0.52
R6016:Casz1 UTSW 4 148934584 missense probably damaging 1.00
R6019:Casz1 UTSW 4 148947038 missense probably damaging 0.99
R6139:Casz1 UTSW 4 148951697 missense probably damaging 1.00
R6223:Casz1 UTSW 4 148933383 missense probably damaging 1.00
R6239:Casz1 UTSW 4 148938277 missense probably damaging 1.00
R6323:Casz1 UTSW 4 148941704 missense possibly damaging 0.89
R6354:Casz1 UTSW 4 148952542 missense unknown
R6454:Casz1 UTSW 4 148951495 missense probably damaging 0.99
R6479:Casz1 UTSW 4 148937078 missense probably damaging 1.00
R6529:Casz1 UTSW 4 148938189 missense probably damaging 1.00
R6772:Casz1 UTSW 4 148943206 missense probably damaging 1.00
R7000:Casz1 UTSW 4 148929236 missense probably damaging 1.00
R7152:Casz1 UTSW 4 148901291 start gained probably benign
X0018:Casz1 UTSW 4 148939008 missense probably damaging 1.00
X0064:Casz1 UTSW 4 148932952 missense probably damaging 0.99
Z1088:Casz1 UTSW 4 148944359 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGTGAACCTGCTTGCTCTTACC -3'
(R):5'- TAAAGCCCTCACCTGCGGAGATAC -3'

Sequencing Primer
(F):5'- GCTTAAATGATGGCTCCAGC -3'
(R):5'- GAGATACACCTTCCAAGGCTCTG -3'
Posted On2014-04-13