Incidental Mutation 'R1541:Znfx1'
ID171708
Institutional Source Beutler Lab
Gene Symbol Znfx1
Ensembl Gene ENSMUSG00000039501
Gene Namezinc finger, NFX1-type containing 1
Synonyms
MMRRC Submission 039580-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1541 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location167035793-167063015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 167056190 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 271 (N271K)
Ref Sequence ENSEMBL: ENSMUSP00000049404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048988] [ENSMUST00000128676] [ENSMUST00000155281]
Predicted Effect probably damaging
Transcript: ENSMUST00000048988
AA Change: N271K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049404
Gene: ENSMUSG00000039501
AA Change: N271K

DomainStartEndE-ValueType
Pfam:AAA_11 590 855 2.2e-17 PFAM
Pfam:AAA_19 597 684 1.7e-10 PFAM
Pfam:AAA_11 829 1033 1.4e-18 PFAM
Pfam:AAA_12 1044 1228 3.7e-42 PFAM
internal_repeat_2 1281 1374 1.33e-7 PROSPERO
internal_repeat_1 1292 1410 1.32e-16 PROSPERO
low complexity region 1422 1433 N/A INTRINSIC
internal_repeat_1 1434 1547 1.32e-16 PROSPERO
internal_repeat_2 1453 1555 1.33e-7 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000128676
AA Change: N271K

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121598
Gene: ENSMUSG00000039501
AA Change: N271K

DomainStartEndE-ValueType
Pfam:AAA_11 590 837 1.8e-17 PFAM
Pfam:AAA_19 597 684 3.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135967
Predicted Effect possibly damaging
Transcript: ENSMUST00000155281
AA Change: N271K

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121750
Gene: ENSMUSG00000039501
AA Change: N271K

DomainStartEndE-ValueType
Pfam:AAA_11 590 854 1.7e-17 PFAM
Pfam:AAA_19 597 684 3.6e-11 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 A G 14: 103,049,333 D24G probably damaging Het
Angptl2 G A 2: 33,246,165 R454H probably benign Het
Atat1 T A 17: 35,904,331 N181I probably damaging Het
Atp6v0d2 A C 4: 19,910,645 F82V probably damaging Het
BC100530 T A 16: 36,367,501 M1L probably damaging Het
Casp3 A G 8: 46,634,334 I105M probably benign Het
Ccdc33 T A 9: 58,117,466 D159V probably damaging Het
Cd163 A C 6: 124,327,961 D1099A probably benign Het
Cep128 A T 12: 91,348,781 S110R probably damaging Het
Cfap43 A T 19: 47,763,852 probably null Het
Cfap58 T C 19: 47,983,530 I633T probably damaging Het
Clvs1 A G 4: 9,281,814 H86R probably benign Het
Comt T C 16: 18,411,815 K48R probably benign Het
Crip2 T C 12: 113,144,966 V64A possibly damaging Het
Cwf19l2 T A 9: 3,456,760 S698T probably damaging Het
Dis3l T C 9: 64,307,489 I933V probably benign Het
Dnah8 C A 17: 30,747,247 N2470K probably damaging Het
Dstn T C 2: 143,938,488 V36A possibly damaging Het
Dtx1 T A 5: 120,710,346 probably benign Het
Dzip1 G A 14: 118,879,478 S782L probably damaging Het
Ece1 T A 4: 137,948,660 probably null Het
Erich1 A G 8: 14,030,688 I277T probably damaging Het
Fam26d T C 10: 34,041,663 H264R probably benign Het
Gbp4 T A 5: 105,118,409 M589L probably benign Het
Gm15448 T C 7: 3,816,989 D525G probably damaging Het
Gm9733 T A 3: 15,320,684 T53S possibly damaging Het
Grip1 T C 10: 120,000,543 I440T probably damaging Het
Helz C T 11: 107,670,048 S1311L probably benign Het
Herc2 A T 7: 56,135,657 I1552F probably damaging Het
Kif13a T C 13: 46,809,213 T459A probably benign Het
Knop1 G A 7: 118,855,786 probably benign Het
Llgl2 C A 11: 115,853,121 T758K probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc71 T C 3: 87,741,841 D340G possibly damaging Het
Luzp1 A G 4: 136,543,325 D953G probably damaging Het
Mst1r T C 9: 107,917,363 V1247A probably damaging Het
Ncoa4 A T 14: 32,176,888 K555M probably damaging Het
Ncoa6 A T 2: 155,415,304 L773Q probably benign Het
Ndc1 C T 4: 107,371,288 Q70* probably null Het
Nfe2l3 C T 6: 51,457,605 L382F probably damaging Het
Nlrp4b C A 7: 10,725,052 T399N possibly damaging Het
Nsmce2 T A 15: 59,601,385 D250E probably damaging Het
Nudt14 A T 12: 112,934,928 L184Q probably damaging Het
Ogdhl G A 14: 32,340,667 R570H possibly damaging Het
Olfr477 T C 7: 107,990,841 F159L probably benign Het
Papd5 T C 8: 88,245,599 V222A probably damaging Het
Plag1 A G 4: 3,904,085 S369P probably benign Het
Ranbp2 A T 10: 58,483,094 T2476S possibly damaging Het
Rnmt T C 18: 68,307,782 L172P probably damaging Het
Sec24a T A 11: 51,743,796 H101L probably benign Het
Srm A G 4: 148,593,424 D173G probably damaging Het
Srp54b A G 12: 55,256,059 D380G probably benign Het
Svs2 C T 2: 164,237,009 R326Q possibly damaging Het
Tfap2b C T 1: 19,234,070 T350M probably damaging Het
Tie1 A T 4: 118,483,873 C304S probably damaging Het
Tsc2 G T 17: 24,631,976 T36N probably damaging Het
Wdhd1 A T 14: 47,268,192 Y274* probably null Het
Wdr37 T C 13: 8,820,538 T373A probably benign Het
Xirp2 A T 2: 67,512,290 N1625I possibly damaging Het
Ythdf1 A C 2: 180,919,143 S35A probably damaging Het
Zfp462 A G 4: 55,008,928 N298S possibly damaging Het
Zfp541 T A 7: 16,078,512 D363E probably benign Het
Zgpat A G 2: 181,378,865 D277G probably benign Het
Other mutations in Znfx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Znfx1 APN 2 167036729 missense possibly damaging 0.65
IGL00492:Znfx1 APN 2 167036923 missense probably damaging 1.00
IGL01285:Znfx1 APN 2 167038695 missense possibly damaging 0.76
IGL01343:Znfx1 APN 2 167037363 missense probably benign 0.16
IGL01767:Znfx1 APN 2 167055723 missense probably damaging 1.00
IGL01983:Znfx1 APN 2 167056350 missense probably damaging 1.00
IGL02006:Znfx1 APN 2 167055763 missense probably damaging 1.00
IGL02254:Znfx1 APN 2 167055723 missense probably damaging 1.00
IGL02421:Znfx1 APN 2 167060080 missense probably damaging 0.97
IGL02496:Znfx1 APN 2 167047630 missense possibly damaging 0.83
IGL02525:Znfx1 APN 2 167037537 missense probably benign 0.00
IGL02528:Znfx1 APN 2 167050404 missense probably benign 0.11
IGL02537:Znfx1 APN 2 167056167 missense probably benign 0.37
IGL03065:Znfx1 APN 2 167055765 missense probably benign 0.00
R0127:Znfx1 UTSW 2 167044210 missense possibly damaging 0.84
R0331:Znfx1 UTSW 2 167046978 missense probably benign 0.11
R0488:Znfx1 UTSW 2 167042563 missense possibly damaging 0.52
R0497:Znfx1 UTSW 2 167055411 missense probably benign 0.03
R0537:Znfx1 UTSW 2 167041701 missense probably damaging 1.00
R0542:Znfx1 UTSW 2 167055655 missense probably damaging 1.00
R0650:Znfx1 UTSW 2 167047654 nonsense probably null
R0655:Znfx1 UTSW 2 167056907 missense probably damaging 1.00
R1104:Znfx1 UTSW 2 167055640 nonsense probably null
R1470:Znfx1 UTSW 2 167042587 missense possibly damaging 0.91
R1470:Znfx1 UTSW 2 167042587 missense possibly damaging 0.91
R1512:Znfx1 UTSW 2 167056317 missense probably benign 0.03
R1533:Znfx1 UTSW 2 167056788 missense probably benign 0.10
R1642:Znfx1 UTSW 2 167039010 missense possibly damaging 0.95
R1720:Znfx1 UTSW 2 167044066 nonsense probably null
R1760:Znfx1 UTSW 2 167039866 missense probably damaging 0.96
R1865:Znfx1 UTSW 2 167038809 missense probably damaging 1.00
R1959:Znfx1 UTSW 2 167050350 missense probably damaging 1.00
R2088:Znfx1 UTSW 2 167055810 missense probably damaging 1.00
R4581:Znfx1 UTSW 2 167050316 missense probably damaging 1.00
R4622:Znfx1 UTSW 2 167041753 missense possibly damaging 0.91
R4649:Znfx1 UTSW 2 167056356 missense probably benign 0.08
R4685:Znfx1 UTSW 2 167039030 missense probably damaging 1.00
R4798:Znfx1 UTSW 2 167038569 unclassified probably null
R4827:Znfx1 UTSW 2 167044231 missense possibly damaging 0.77
R4870:Znfx1 UTSW 2 167055269 missense probably benign
R4910:Znfx1 UTSW 2 167036804 missense probably damaging 1.00
R4910:Znfx1 UTSW 2 167037482 missense probably benign 0.00
R5022:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5023:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5057:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5061:Znfx1 UTSW 2 167065398 unclassified probably benign
R5119:Znfx1 UTSW 2 167065387 unclassified probably benign
R5125:Znfx1 UTSW 2 167046939 missense possibly damaging 0.81
R5896:Znfx1 UTSW 2 167039000 missense probably damaging 1.00
R6107:Znfx1 UTSW 2 167037081 missense possibly damaging 0.67
R6112:Znfx1 UTSW 2 167038206 missense probably benign
R6158:Znfx1 UTSW 2 167056726 missense probably benign 0.19
R6281:Znfx1 UTSW 2 167055885 missense probably damaging 1.00
R6464:Znfx1 UTSW 2 167046922 missense probably benign 0.34
R6749:Znfx1 UTSW 2 167056599 missense probably benign 0.00
R6888:Znfx1 UTSW 2 167038940 missense possibly damaging 0.91
R6973:Znfx1 UTSW 2 167056761 missense probably benign 0.18
R7017:Znfx1 UTSW 2 167048534 missense probably damaging 1.00
R7138:Znfx1 UTSW 2 167056777 missense probably benign 0.03
X0064:Znfx1 UTSW 2 167055256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGCAGTGCTCTCGTATTTCCC -3'
(R):5'- GGCATCCTGAACAACTCCAAGTTCC -3'

Sequencing Primer
(F):5'- CGAAGGAAGGGCTTCTCATC -3'
(R):5'- GAGTCTGCCTGCCAGCTTAC -3'
Posted On2014-04-13