Incidental Mutation 'R1543:Pcx'
ID171961
Institutional Source Beutler Lab
Gene Symbol Pcx
Ensembl Gene ENSMUSG00000024892
Gene Namepyruvate carboxylase
SynonymsPc
MMRRC Submission 039582-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1543 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4510472-4621752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4602223 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 112 (D112V)
Ref Sequence ENSEMBL: ENSMUSP00000152918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068004] [ENSMUST00000113825] [ENSMUST00000224726] [ENSMUST00000225189]
Predicted Effect probably damaging
Transcript: ENSMUST00000068004
AA Change: D113V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063825
Gene: ENSMUSG00000024892
AA Change: D113V

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:CPSase_L_chain 37 147 3.3e-45 PFAM
Pfam:ATP-grasp_4 149 334 3.9e-19 PFAM
Pfam:CPSase_L_D2 152 361 7.2e-77 PFAM
Pfam:Dala_Dala_lig_C 161 329 1.5e-11 PFAM
Biotin_carb_C 376 483 1.21e-50 SMART
low complexity region 513 541 N/A INTRINSIC
Pfam:HMGL-like 564 838 8.2e-29 PFAM
Pfam:PYC_OADA 862 1062 1.4e-72 PFAM
Pfam:Biotin_lipoyl 1111 1178 1.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113825
AA Change: D112V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109456
Gene: ENSMUSG00000024892
AA Change: D112V

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
Pfam:CPSase_L_chain 36 146 1.1e-43 PFAM
Pfam:ATP-grasp_4 148 332 2.9e-19 PFAM
Pfam:CPSase_L_D2 151 360 4.2e-77 PFAM
Pfam:Dala_Dala_lig_C 158 328 7.9e-13 PFAM
Biotin_carb_C 375 482 1.21e-50 SMART
low complexity region 512 540 N/A INTRINSIC
Pfam:HMGL-like 571 821 3.4e-28 PFAM
Pfam:PYC_OADA 861 1062 3.4e-69 PFAM
Pfam:Biotin_lipoyl 1110 1177 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224726
AA Change: D112V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000225189
AA Change: D112V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.708 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.2%
Validation Efficiency 95% (77/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes pyruvate carboxylase, which requires biotin and ATP to catalyse the carboxylation of pyruvate to oxaloacetate. The active enzyme is a homotetramer arranged in a tetrahedron which is located exclusively in the mitochondrial matrix. Pyruvate carboxylase is involved in gluconeogenesis, lipogenesis, insulin secretion and synthesis of the neurotransmitter glutamate. Mutations in this gene have been associated with pyruvate carboxylase deficiency. Alternatively spliced transcript variants with different 5' UTRs, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik G A 6: 40,968,204 V206I probably damaging Het
2610507B11Rik A G 11: 78,275,174 T1422A probably benign Het
4933425L06Rik A T 13: 105,112,369 R364* probably null Het
Abca8b A C 11: 109,974,674 M319R probably damaging Het
Abcc6 T C 7: 46,016,504 R231G probably benign Het
Acadm A G 3: 153,929,572 Y302H probably damaging Het
Acox3 C A 5: 35,603,008 R423S probably damaging Het
Adam7 T A 14: 68,521,922 probably benign Het
Adgrb3 A C 1: 25,488,088 M589R probably benign Het
Adgrl2 A C 3: 148,859,273 F224V probably damaging Het
Adm2 G C 15: 89,324,079 G74A probably damaging Het
Aen T A 7: 78,902,622 V15E probably damaging Het
Ankzf1 T A 1: 75,192,516 V22D possibly damaging Het
Arap2 T A 5: 62,606,155 K1549* probably null Het
Arhgef11 G A 3: 87,713,017 R430H probably benign Het
Asb17 T G 3: 153,844,511 L60W probably damaging Het
BC035044 T C 6: 128,890,985 probably benign Het
Cacna2d1 A T 5: 16,266,718 M254L possibly damaging Het
Celf6 T C 9: 59,603,877 probably benign Het
Coro2b C T 9: 62,425,841 V120I probably benign Het
Cyp20a1 C A 1: 60,376,194 probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dclk3 A G 9: 111,468,054 H222R probably benign Het
Deaf1 A G 7: 141,324,147 S109P possibly damaging Het
Dlg5 T A 14: 24,144,448 D1675V probably damaging Het
Dsg2 T A 18: 20,594,211 V605E probably benign Het
Frem2 A T 3: 53,572,455 I1939N possibly damaging Het
Fsip2 A T 2: 82,981,587 Y2750F possibly damaging Het
Gpr39 T A 1: 125,872,424 I304N probably damaging Het
Hdac7 G A 15: 97,809,529 probably benign Het
Hipk1 T C 3: 103,778,164 H45R probably benign Het
Hyal2 T C 9: 107,570,187 L13P probably damaging Het
Kdm1b C T 13: 47,068,521 R479W probably damaging Het
Lilr4b A G 10: 51,481,421 T118A probably damaging Het
Lin7a C A 10: 107,412,069 F78L possibly damaging Het
Lpin3 A G 2: 160,895,390 D119G possibly damaging Het
Lrp2 G A 2: 69,500,730 R1661C probably damaging Het
Lrrc45 A G 11: 120,720,018 K527E probably benign Het
Map10 C T 8: 125,670,872 P335S probably benign Het
Mast3 A G 8: 70,792,311 S2P possibly damaging Het
Mbtps1 A G 8: 119,542,069 probably benign Het
Mms22l T A 4: 24,591,084 N1018K probably benign Het
Nckipsd C A 9: 108,812,372 A244D possibly damaging Het
Olfr1294 A G 2: 111,537,797 V164A probably benign Het
Olfr3 A T 2: 36,813,057 F12I probably damaging Het
Olfr358 C A 2: 37,005,127 L162F probably damaging Het
Olfr592 T A 7: 103,187,214 F204L probably benign Het
Olfr876 T A 9: 37,803,947 I12N possibly damaging Het
Phf14 G A 6: 11,987,683 probably null Het
Pkd1l1 A G 11: 8,901,200 I744T probably damaging Het
Ppip5k2 A G 1: 97,740,882 L560P probably damaging Het
Psmd14 A T 2: 61,785,530 M248L probably benign Het
Ryr1 T G 7: 29,083,537 E1884A possibly damaging Het
Scn4b T A 9: 45,150,429 S204R probably damaging Het
Slc12a1 A T 2: 125,184,857 M471L possibly damaging Het
Slc17a5 A G 9: 78,560,800 V236A probably benign Het
Sobp T C 10: 43,021,724 T622A probably damaging Het
Spata31d1a G T 13: 59,702,242 R691S probably benign Het
Speg A G 1: 75,421,951 E2014G probably damaging Het
Steap4 A G 5: 7,975,902 probably benign Het
Tas2r144 G A 6: 42,215,603 M92I probably benign Het
Tbc1d5 T C 17: 50,935,532 Q179R probably benign Het
Tcf25 T C 8: 123,388,587 Y188H probably benign Het
Tmem2 G T 19: 21,812,573 A668S probably benign Het
Tmem200a G A 10: 26,078,620 probably benign Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Tssk5 T C 15: 76,372,209 T337A probably benign Het
Ttc23 T C 7: 67,678,995 V228A probably benign Het
Tulp1 A T 17: 28,362,671 probably benign Het
Uqcc3 A G 19: 8,880,753 F25L probably damaging Het
Vmn2r1 G A 3: 64,089,573 G217S probably damaging Het
Vmn2r120 C T 17: 57,522,374 E508K probably benign Het
Wdfy3 C A 5: 101,844,081 V3451L probably benign Het
Wdr19 G A 5: 65,224,690 V418I probably benign Het
Wdr60 T C 12: 116,231,784 probably benign Het
Xirp2 C T 2: 67,508,039 T208I probably benign Het
Xpnpep1 A G 19: 52,991,676 V639A probably benign Het
Other mutations in Pcx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Pcx APN 19 4620937 missense probably benign 0.02
IGL01339:Pcx APN 19 4620235 unclassified probably null
IGL01373:Pcx APN 19 4620235 unclassified probably null
IGL01704:Pcx APN 19 4621060 missense probably damaging 1.00
IGL02223:Pcx APN 19 4601978 missense probably damaging 1.00
PIT4151001:Pcx UTSW 19 4603129 missense probably damaging 1.00
R0098:Pcx UTSW 19 4601747 splice site probably benign
R0098:Pcx UTSW 19 4601747 splice site probably benign
R0211:Pcx UTSW 19 4620199 missense probably damaging 1.00
R0211:Pcx UTSW 19 4620199 missense probably damaging 1.00
R0398:Pcx UTSW 19 4601610 missense probably benign 0.35
R0414:Pcx UTSW 19 4607642 missense possibly damaging 0.60
R1402:Pcx UTSW 19 4602030 missense possibly damaging 0.59
R1402:Pcx UTSW 19 4602030 missense possibly damaging 0.59
R1479:Pcx UTSW 19 4602024 missense probably damaging 1.00
R1559:Pcx UTSW 19 4619086 missense probably damaging 1.00
R1607:Pcx UTSW 19 4603159 missense possibly damaging 0.89
R1833:Pcx UTSW 19 4619104 missense probably damaging 0.98
R1866:Pcx UTSW 19 4621221 missense possibly damaging 0.58
R2131:Pcx UTSW 19 4602551 missense probably benign 0.00
R2172:Pcx UTSW 19 4620881 missense probably benign 0.17
R2224:Pcx UTSW 19 4617998 missense possibly damaging 0.46
R2226:Pcx UTSW 19 4617998 missense possibly damaging 0.46
R2280:Pcx UTSW 19 4604543 missense probably damaging 1.00
R3950:Pcx UTSW 19 4617967 missense probably benign 0.00
R3952:Pcx UTSW 19 4617967 missense probably benign 0.00
R4205:Pcx UTSW 19 4619166 missense possibly damaging 0.95
R4409:Pcx UTSW 19 4610003 missense possibly damaging 0.65
R4670:Pcx UTSW 19 4619888 missense probably damaging 1.00
R4691:Pcx UTSW 19 4619477 missense probably damaging 0.99
R4728:Pcx UTSW 19 4603096 missense probably damaging 1.00
R4808:Pcx UTSW 19 4620928 missense probably benign 0.00
R5200:Pcx UTSW 19 4618504 missense probably damaging 1.00
R5454:Pcx UTSW 19 4602476 missense probably damaging 1.00
R5621:Pcx UTSW 19 4619167 missense possibly damaging 0.59
R5990:Pcx UTSW 19 4621266 missense probably damaging 1.00
R6519:Pcx UTSW 19 4602211 missense possibly damaging 0.64
R6526:Pcx UTSW 19 4604495 missense probably benign 0.44
R7202:Pcx UTSW 19 4602333 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CAGGCAGAAAGCTGATGAAGCCTAC -3'
(R):5'- AGAATCCTCACGCCATCTTGTCAC -3'

Sequencing Primer
(F):5'- TTCCAGACATCATCAAGGTGGC -3'
(R):5'- CCATCTTGTCACAGGCCC -3'
Posted On2014-04-13