Incidental Mutation 'R1544:Rin2'
ID171982
Institutional Source Beutler Lab
Gene Symbol Rin2
Ensembl Gene ENSMUSG00000001768
Gene NameRas and Rab interactor 2
SynonymsRASSF4, 4632403N06Rik, 2010003K16Rik
MMRRC Submission 039583-MU
Accession Numbers

Genbank: NM_028724; MGI: 1921280; Ensembl: ENSMUST00000110005

Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R1544 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location145675215-145887616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145858446 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 181 (V181A)
Ref Sequence ENSEMBL: ENSMUSP00000105632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094480] [ENSMUST00000110005] [ENSMUST00000147976]
Predicted Effect probably damaging
Transcript: ENSMUST00000094480
AA Change: V136A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092053
Gene: ENSMUSG00000001768
AA Change: V136A

DomainStartEndE-ValueType
SH2 50 136 1.38e-3 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 375 385 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
Blast:SH2 540 576 2e-7 BLAST
VPS9 612 730 1.72e-68 SMART
RA 751 842 3.35e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110005
AA Change: V181A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105632
Gene: ENSMUSG00000001768
AA Change: V181A

DomainStartEndE-ValueType
SH2 95 181 1.38e-3 SMART
low complexity region 220 232 N/A INTRINSIC
low complexity region 303 314 N/A INTRINSIC
low complexity region 380 397 N/A INTRINSIC
low complexity region 420 430 N/A INTRINSIC
low complexity region 438 456 N/A INTRINSIC
Blast:SH2 585 621 2e-7 BLAST
VPS9 657 775 1.72e-68 SMART
RA 796 887 3.35e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145874
Predicted Effect probably benign
Transcript: ENSMUST00000147976
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.9%
Validation Efficiency 99% (114/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RAB5 protein is a small GTPase involved in membrane trafficking in the early endocytic pathway. The protein encoded by this gene binds the GTP-bound form of the RAB5 protein preferentially over the GDP-bound form, and functions as a guanine nucleotide exchange factor for RAB5. The encoded protein is found primarily as a tetramer in the cytoplasm and does not bind other members of the RAB family. Mutations in this gene cause macrocephaly alopecia cutis laxa and scoliosis (MACS) syndrome, an elastic tissue disorder, as well as the related connective tissue disorder, RIN2 syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A C X: 18,420,462 L285V possibly damaging Het
4931406B18Rik A G 7: 43,498,119 I182T possibly damaging Het
4933406P04Rik A G 10: 20,311,359 probably benign Het
4933425L06Rik A T 13: 105,109,621 H230L probably benign Het
A730018C14Rik A G 12: 112,415,490 noncoding transcript Het
Aacs A T 5: 125,516,330 I666F possibly damaging Het
Abcb9 C T 5: 124,083,631 V227I probably benign Het
Abcd3 T C 3: 121,784,473 Q168R probably benign Het
Adamts4 A G 1: 171,252,742 Q288R probably benign Het
Atad2 G A 15: 58,103,364 A611V probably damaging Het
Aup1 T C 6: 83,055,206 V118A possibly damaging Het
Bend7 T A 2: 4,763,311 probably benign Het
Brd4 A G 17: 32,198,672 probably benign Het
C4b C A 17: 34,738,967 R580L probably benign Het
Cct8 G T 16: 87,491,454 probably benign Het
Cilp T C 9: 65,275,845 Y344H probably benign Het
Clic6 A T 16: 92,492,073 probably benign Het
Colgalt2 T C 1: 152,484,952 S247P probably damaging Het
Csf2rb G T 15: 78,340,755 A212S probably benign Het
Csmd3 A C 15: 47,611,898 probably null Het
Cyp26c1 A G 19: 37,690,945 D366G probably benign Het
Dhx33 A G 11: 70,999,528 S222P probably damaging Het
Dhx40 T A 11: 86,806,553 I63F possibly damaging Het
Dlgap2 T A 8: 14,829,861 probably null Het
Dnah7b T A 1: 46,066,797 D20E unknown Het
Dnase2b C A 3: 146,584,557 A220S probably benign Het
Dock10 T C 1: 80,592,635 E362G probably benign Het
Ect2l C T 10: 18,168,434 V226I probably benign Het
Epha10 C A 4: 124,885,596 N78K probably damaging Het
Epha3 A G 16: 63,773,053 V224A probably damaging Het
Fam126a A T 5: 23,965,141 D403E probably benign Het
Fam208b A T 13: 3,590,413 H241Q possibly damaging Het
Fcgr4 C A 1: 171,019,954 D40E probably damaging Het
Fer1l4 T C 2: 156,045,633 M548V probably benign Het
Flii C T 11: 60,719,692 probably null Het
Flnc A T 6: 29,444,080 Y631F probably benign Het
Gm13101 T C 4: 143,966,062 D123G probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm4788 A T 1: 139,736,870 C484S probably damaging Het
Gm6871 A C 7: 41,546,090 probably null Het
Gtf2ird1 A T 5: 134,358,918 S1028T possibly damaging Het
Hydin A G 8: 110,574,854 H3739R probably benign Het
Iqcg A T 16: 33,045,525 N149K probably benign Het
Iqgap3 A G 3: 88,098,893 D537G probably benign Het
Itih2 T G 2: 10,105,214 D576A probably benign Het
Kcmf1 T C 6: 72,848,229 T243A probably benign Het
Kif1a A G 1: 93,074,948 probably benign Het
Klf10 C T 15: 38,296,786 G337S probably damaging Het
Krt31 T C 11: 100,047,873 N298S possibly damaging Het
Lmnb1 A G 18: 56,749,751 E556G probably benign Het
Mael A T 1: 166,202,290 S354T probably benign Het
Mast3 T C 8: 70,786,172 D496G probably damaging Het
Med12l A G 3: 59,265,240 T1806A possibly damaging Het
Mms19 A G 19: 41,955,821 probably null Het
Moap1 A T 12: 102,743,245 M15K possibly damaging Het
Mpv17l G T 16: 13,946,819 W70L probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myo7b T C 18: 31,994,909 I577V probably benign Het
Myo9b T A 8: 71,290,976 L227Q probably damaging Het
Myom2 T C 8: 15,104,059 probably benign Het
Naip6 C A 13: 100,316,475 R26L probably benign Het
Nbea T C 3: 56,058,827 T405A probably damaging Het
Nrp2 T A 1: 62,762,904 I502N probably damaging Het
Nufip2 G A 11: 77,691,907 E216K possibly damaging Het
Oaf A G 9: 43,222,633 Y264H probably damaging Het
Olfr1023 T C 2: 85,887,271 L157P probably damaging Het
Olfr643 A G 7: 104,059,224 V126A probably damaging Het
Olfr815 A T 10: 129,902,424 C95* probably null Het
Pax1 T C 2: 147,368,401 V352A probably damaging Het
Pkd1l2 TGGG TGG 8: 117,038,235 probably null Het
Plxna3 G A X: 74,340,166 probably null Het
Pnpla3 T C 15: 84,181,046 V347A probably benign Het
Ppl T A 16: 5,102,597 K350* probably null Het
Prb1 C A 6: 132,209,460 probably null Het
Prb1 T A 6: 132,209,461 probably null Het
Ptpn11 G A 5: 121,137,511 H540Y probably benign Het
Ptprz1 C A 6: 23,000,748 H946N possibly damaging Het
Rad51b A G 12: 79,302,543 E51G possibly damaging Het
Rnf157 T A 11: 116,354,362 probably null Het
Rnf207 A G 4: 152,313,871 probably benign Het
Ror1 A T 4: 100,441,986 K852M probably damaging Het
Sbp T A 17: 23,945,069 I102K probably benign Het
Scaf8 T C 17: 3,145,154 I33T probably damaging Het
Scn5a C T 9: 119,486,633 V1670I probably damaging Het
Serhl C T 15: 83,105,676 T42M probably damaging Het
Sin3a A G 9: 57,103,997 probably benign Het
Slc12a2 A G 18: 57,879,302 S166G probably benign Het
Slc15a4 G A 5: 127,603,768 H396Y probably benign Het
Slc2a7 A T 4: 150,154,686 N123Y probably damaging Het
Smpd3 G A 8: 106,265,567 T118M possibly damaging Het
Spns2 A T 11: 72,456,367 I427N probably benign Het
Ssmem1 T A 6: 30,519,651 S112T probably damaging Het
Stard10 A T 7: 101,344,026 D190V probably damaging Het
Stil A T 4: 115,023,852 K531M probably damaging Het
Strc T C 2: 121,372,738 probably null Het
Svil T A 18: 5,046,817 I21N possibly damaging Het
Syt11 T C 3: 88,748,803 M14V probably benign Het
Tg A T 15: 66,705,232 Q1468L probably benign Het
Tjp1 A G 7: 65,302,921 V1555A probably benign Het
Tmprss11d A C 5: 86,338,799 S77R probably damaging Het
Tsnaxip1 A G 8: 105,827,751 probably benign Het
Tyr C A 7: 87,492,706 L138F probably damaging Het
Ubash3b A G 9: 41,016,605 V469A probably damaging Het
Ugt8a T C 3: 125,915,449 Y4C probably benign Het
Vmn1r201 A T 13: 22,474,798 T61S probably benign Het
Vmn1r204 A G 13: 22,556,295 H32R probably benign Het
Vmn1r228 T A 17: 20,777,023 I78L probably benign Het
Wdr90 T C 17: 25,849,310 D1348G possibly damaging Het
Zfp563 T A 17: 33,105,213 C261S probably benign Het
Zfp809 T A 9: 22,235,099 L28Q probably damaging Het
Znrf3 T A 11: 5,289,066 Q99L probably damaging Het
Other mutations in Rin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02928:Rin2 APN 2 145860006 splice site probably benign
IGL03222:Rin2 APN 2 145860195 nonsense probably null
IGL03371:Rin2 APN 2 145885926 utr 3 prime probably benign
IGL03411:Rin2 APN 2 145860944 missense probably damaging 0.99
D4043:Rin2 UTSW 2 145822363 missense possibly damaging 0.61
R0025:Rin2 UTSW 2 145878832 splice site probably benign
R0110:Rin2 UTSW 2 145861033 missense probably benign
R0144:Rin2 UTSW 2 145876639 missense probably damaging 0.96
R0510:Rin2 UTSW 2 145861033 missense probably benign
R1326:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1327:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1328:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1329:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1330:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1658:Rin2 UTSW 2 145876456 missense probably benign 0.04
R1832:Rin2 UTSW 2 145861171 missense possibly damaging 0.48
R1986:Rin2 UTSW 2 145878940 missense probably damaging 1.00
R2137:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2167:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2170:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2260:Rin2 UTSW 2 145878904 missense probably damaging 0.97
R2312:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2884:Rin2 UTSW 2 145860991 missense probably benign 0.07
R3155:Rin2 UTSW 2 145860851 missense probably benign 0.17
R3771:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3772:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3773:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3822:Rin2 UTSW 2 145822630 missense probably benign 0.02
R3824:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3825:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3885:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3893:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3939:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3940:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4012:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4019:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4058:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4214:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4231:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4232:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4236:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4372:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4410:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4415:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4471:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4490:Rin2 UTSW 2 145822274 missense possibly damaging 0.66
R4597:Rin2 UTSW 2 145860905 missense probably benign 0.01
R5099:Rin2 UTSW 2 145878901 missense probably damaging 1.00
R5268:Rin2 UTSW 2 145844760 missense probably benign
R5493:Rin2 UTSW 2 145860709 missense probably damaging 1.00
R5622:Rin2 UTSW 2 145860379 missense probably benign 0.07
R5947:Rin2 UTSW 2 145844943 intron probably benign
R6280:Rin2 UTSW 2 145861019 missense probably damaging 1.00
R7009:Rin2 UTSW 2 145883475 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGGAGTGATGAGATTGCCAGC -3'
(R):5'- TTGATGTAGCATGGGGCCACAAG -3'

Sequencing Primer
(F):5'- CCATCAGGGAGACTTGATCATTG -3'
(R):5'- CGTCTTGGCTGTTGAAATGG -3'
Posted On2014-04-13