Incidental Mutation 'R1544:Med12l'
ID171986
Institutional Source Beutler Lab
Gene Symbol Med12l
Ensembl Gene ENSMUSG00000056476
Gene Namemediator complex subunit 12-like
Synonyms
MMRRC Submission 039583-MU
Accession Numbers

NCBI RefSeq: NM_177855.3; MGI: 2139916

Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R1544 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location59005825-59318682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59265240 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1806 (T1806A)
Ref Sequence ENSEMBL: ENSMUSP00000127038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000050360] [ENSMUST00000164225] [ENSMUST00000199609] [ENSMUST00000199659]
Predicted Effect probably benign
Transcript: ENSMUST00000040325
AA Change: T1771A

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476
AA Change: T1771A

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050360
SMART Domains Protein: ENSMUSP00000051353
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 48 304 1.3e-40 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164225
AA Change: T1806A

PolyPhen 2 Score 0.706 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476
AA Change: T1806A

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199400
Predicted Effect probably benign
Transcript: ENSMUST00000199609
SMART Domains Protein: ENSMUSP00000143521
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 1.5e-31 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199659
AA Change: T1804A

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476
AA Change: T1804A

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.9%
Validation Efficiency 99% (114/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A C X: 18,420,462 L285V possibly damaging Het
4931406B18Rik A G 7: 43,498,119 I182T possibly damaging Het
4933406P04Rik A G 10: 20,311,359 probably benign Het
4933425L06Rik A T 13: 105,109,621 H230L probably benign Het
A730018C14Rik A G 12: 112,415,490 noncoding transcript Het
Aacs A T 5: 125,516,330 I666F possibly damaging Het
Abcb9 C T 5: 124,083,631 V227I probably benign Het
Abcd3 T C 3: 121,784,473 Q168R probably benign Het
Adamts4 A G 1: 171,252,742 Q288R probably benign Het
Atad2 G A 15: 58,103,364 A611V probably damaging Het
Aup1 T C 6: 83,055,206 V118A possibly damaging Het
Bend7 T A 2: 4,763,311 probably benign Het
Brd4 A G 17: 32,198,672 probably benign Het
C4b C A 17: 34,738,967 R580L probably benign Het
Cct8 G T 16: 87,491,454 probably benign Het
Cilp T C 9: 65,275,845 Y344H probably benign Het
Clic6 A T 16: 92,492,073 probably benign Het
Colgalt2 T C 1: 152,484,952 S247P probably damaging Het
Csf2rb G T 15: 78,340,755 A212S probably benign Het
Csmd3 A C 15: 47,611,898 probably null Het
Cyp26c1 A G 19: 37,690,945 D366G probably benign Het
Dhx33 A G 11: 70,999,528 S222P probably damaging Het
Dhx40 T A 11: 86,806,553 I63F possibly damaging Het
Dlgap2 T A 8: 14,829,861 probably null Het
Dnah7b T A 1: 46,066,797 D20E unknown Het
Dnase2b C A 3: 146,584,557 A220S probably benign Het
Dock10 T C 1: 80,592,635 E362G probably benign Het
Ect2l C T 10: 18,168,434 V226I probably benign Het
Epha10 C A 4: 124,885,596 N78K probably damaging Het
Epha3 A G 16: 63,773,053 V224A probably damaging Het
Fam126a A T 5: 23,965,141 D403E probably benign Het
Fam208b A T 13: 3,590,413 H241Q possibly damaging Het
Fcgr4 C A 1: 171,019,954 D40E probably damaging Het
Fer1l4 T C 2: 156,045,633 M548V probably benign Het
Flii C T 11: 60,719,692 probably null Het
Flnc A T 6: 29,444,080 Y631F probably benign Het
Gm13101 T C 4: 143,966,062 D123G probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm4788 A T 1: 139,736,870 C484S probably damaging Het
Gm6871 A C 7: 41,546,090 probably null Het
Gtf2ird1 A T 5: 134,358,918 S1028T possibly damaging Het
Hydin A G 8: 110,574,854 H3739R probably benign Het
Iqcg A T 16: 33,045,525 N149K probably benign Het
Iqgap3 A G 3: 88,098,893 D537G probably benign Het
Itih2 T G 2: 10,105,214 D576A probably benign Het
Kcmf1 T C 6: 72,848,229 T243A probably benign Het
Kif1a A G 1: 93,074,948 probably benign Het
Klf10 C T 15: 38,296,786 G337S probably damaging Het
Krt31 T C 11: 100,047,873 N298S possibly damaging Het
Lmnb1 A G 18: 56,749,751 E556G probably benign Het
Mael A T 1: 166,202,290 S354T probably benign Het
Mast3 T C 8: 70,786,172 D496G probably damaging Het
Mms19 A G 19: 41,955,821 probably null Het
Moap1 A T 12: 102,743,245 M15K possibly damaging Het
Mpv17l G T 16: 13,946,819 W70L probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myo7b T C 18: 31,994,909 I577V probably benign Het
Myo9b T A 8: 71,290,976 L227Q probably damaging Het
Myom2 T C 8: 15,104,059 probably benign Het
Naip6 C A 13: 100,316,475 R26L probably benign Het
Nbea T C 3: 56,058,827 T405A probably damaging Het
Nrp2 T A 1: 62,762,904 I502N probably damaging Het
Nufip2 G A 11: 77,691,907 E216K possibly damaging Het
Oaf A G 9: 43,222,633 Y264H probably damaging Het
Olfr1023 T C 2: 85,887,271 L157P probably damaging Het
Olfr643 A G 7: 104,059,224 V126A probably damaging Het
Olfr815 A T 10: 129,902,424 C95* probably null Het
Pax1 T C 2: 147,368,401 V352A probably damaging Het
Pkd1l2 TGGG TGG 8: 117,038,235 probably null Het
Plxna3 G A X: 74,340,166 probably null Het
Pnpla3 T C 15: 84,181,046 V347A probably benign Het
Ppl T A 16: 5,102,597 K350* probably null Het
Prb1 C A 6: 132,209,460 probably null Het
Prb1 T A 6: 132,209,461 probably null Het
Ptpn11 G A 5: 121,137,511 H540Y probably benign Het
Ptprz1 C A 6: 23,000,748 H946N possibly damaging Het
Rad51b A G 12: 79,302,543 E51G possibly damaging Het
Rin2 T C 2: 145,858,446 V181A probably damaging Het
Rnf157 T A 11: 116,354,362 probably null Het
Rnf207 A G 4: 152,313,871 probably benign Het
Ror1 A T 4: 100,441,986 K852M probably damaging Het
Sbp T A 17: 23,945,069 I102K probably benign Het
Scaf8 T C 17: 3,145,154 I33T probably damaging Het
Scn5a C T 9: 119,486,633 V1670I probably damaging Het
Serhl C T 15: 83,105,676 T42M probably damaging Het
Sin3a A G 9: 57,103,997 probably benign Het
Slc12a2 A G 18: 57,879,302 S166G probably benign Het
Slc15a4 G A 5: 127,603,768 H396Y probably benign Het
Slc2a7 A T 4: 150,154,686 N123Y probably damaging Het
Smpd3 G A 8: 106,265,567 T118M possibly damaging Het
Spns2 A T 11: 72,456,367 I427N probably benign Het
Ssmem1 T A 6: 30,519,651 S112T probably damaging Het
Stard10 A T 7: 101,344,026 D190V probably damaging Het
Stil A T 4: 115,023,852 K531M probably damaging Het
Strc T C 2: 121,372,738 probably null Het
Svil T A 18: 5,046,817 I21N possibly damaging Het
Syt11 T C 3: 88,748,803 M14V probably benign Het
Tg A T 15: 66,705,232 Q1468L probably benign Het
Tjp1 A G 7: 65,302,921 V1555A probably benign Het
Tmprss11d A C 5: 86,338,799 S77R probably damaging Het
Tsnaxip1 A G 8: 105,827,751 probably benign Het
Tyr C A 7: 87,492,706 L138F probably damaging Het
Ubash3b A G 9: 41,016,605 V469A probably damaging Het
Ugt8a T C 3: 125,915,449 Y4C probably benign Het
Vmn1r201 A T 13: 22,474,798 T61S probably benign Het
Vmn1r204 A G 13: 22,556,295 H32R probably benign Het
Vmn1r228 T A 17: 20,777,023 I78L probably benign Het
Wdr90 T C 17: 25,849,310 D1348G possibly damaging Het
Zfp563 T A 17: 33,105,213 C261S probably benign Het
Zfp809 T A 9: 22,235,099 L28Q probably damaging Het
Znrf3 T A 11: 5,289,066 Q99L probably damaging Het
Other mutations in Med12l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Med12l APN 3 59042336 missense probably damaging 0.98
IGL00561:Med12l APN 3 59227824 missense probably benign
IGL00974:Med12l APN 3 59083014 missense probably damaging 1.00
IGL01024:Med12l APN 3 59073341 missense probably damaging 1.00
IGL01094:Med12l APN 3 59093655 missense probably damaging 0.99
IGL01134:Med12l APN 3 59042275 missense possibly damaging 0.91
IGL01535:Med12l APN 3 59262259 missense probably damaging 1.00
IGL01653:Med12l APN 3 59261893 missense probably damaging 1.00
IGL01735:Med12l APN 3 59263254 missense probably damaging 1.00
IGL01972:Med12l APN 3 59261893 missense probably damaging 1.00
IGL02005:Med12l APN 3 59244947 missense probably damaging 1.00
IGL02098:Med12l APN 3 59275855 missense possibly damaging 0.92
IGL02115:Med12l APN 3 59068319 missense probably benign 0.00
IGL02231:Med12l APN 3 59245882 missense probably damaging 1.00
IGL02259:Med12l APN 3 59245843 missense probably damaging 1.00
IGL02369:Med12l APN 3 59257373 missense probably benign 0.00
IGL02424:Med12l APN 3 59092722 missense probably benign 0.21
IGL02501:Med12l APN 3 59261976 missense possibly damaging 0.71
IGL02525:Med12l APN 3 59068368 missense probably benign 0.01
IGL02530:Med12l APN 3 59077089 missense probably damaging 1.00
IGL02735:Med12l APN 3 59093646 missense probably damaging 1.00
IGL02865:Med12l APN 3 59294292 missense probably damaging 1.00
IGL03183:Med12l APN 3 59037555 splice site probably null
IGL03264:Med12l APN 3 59301367 nonsense probably null
FR4304:Med12l UTSW 3 59275982 small insertion probably benign
FR4340:Med12l UTSW 3 59275985 small insertion probably benign
FR4342:Med12l UTSW 3 59275988 small insertion probably benign
FR4342:Med12l UTSW 3 59275994 small insertion probably benign
FR4449:Med12l UTSW 3 59275963 nonsense probably null
FR4548:Med12l UTSW 3 59275982 small insertion probably benign
FR4589:Med12l UTSW 3 59275956 small insertion probably benign
FR4976:Med12l UTSW 3 59275977 small insertion probably benign
P0007:Med12l UTSW 3 59091395 splice site probably benign
P0045:Med12l UTSW 3 59091535 missense probably damaging 0.99
R0030:Med12l UTSW 3 59248655 missense probably damaging 1.00
R0030:Med12l UTSW 3 59248655 missense probably damaging 1.00
R0148:Med12l UTSW 3 59037654 missense probably damaging 1.00
R0325:Med12l UTSW 3 59077059 missense possibly damaging 0.88
R0330:Med12l UTSW 3 59227702 missense probably damaging 1.00
R0388:Med12l UTSW 3 59093504 splice site probably benign
R0542:Med12l UTSW 3 59042401 missense probably damaging 1.00
R0624:Med12l UTSW 3 59037702 nonsense probably null
R0625:Med12l UTSW 3 59247437 missense probably damaging 1.00
R0671:Med12l UTSW 3 59264929 missense probably damaging 1.00
R0706:Med12l UTSW 3 59261980 missense probably damaging 1.00
R0785:Med12l UTSW 3 59260832 missense probably damaging 1.00
R1054:Med12l UTSW 3 59248651 missense probably damaging 0.99
R1102:Med12l UTSW 3 59244836 missense probably damaging 0.99
R1391:Med12l UTSW 3 59037738 missense probably benign 0.00
R1501:Med12l UTSW 3 59260835 critical splice donor site probably null
R1662:Med12l UTSW 3 59093617 missense probably damaging 1.00
R1670:Med12l UTSW 3 59275958 small insertion probably benign
R1839:Med12l UTSW 3 59068319 missense probably benign
R1854:Med12l UTSW 3 59260772 missense probably damaging 1.00
R2045:Med12l UTSW 3 59262310 nonsense probably null
R2070:Med12l UTSW 3 59244905 missense probably damaging 1.00
R2132:Med12l UTSW 3 59265282 unclassified probably null
R2290:Med12l UTSW 3 59244938 missense probably damaging 1.00
R2325:Med12l UTSW 3 59232454 missense probably damaging 0.99
R2352:Med12l UTSW 3 59240692 missense probably damaging 1.00
R2484:Med12l UTSW 3 59297838 missense probably benign 0.18
R2906:Med12l UTSW 3 59257082 missense probably damaging 1.00
R3735:Med12l UTSW 3 59091495 missense probably damaging 1.00
R3736:Med12l UTSW 3 59091495 missense probably damaging 1.00
R3774:Med12l UTSW 3 59247942 missense probably damaging 0.97
R3957:Med12l UTSW 3 59073168 missense probably damaging 0.99
R4020:Med12l UTSW 3 59247942 missense probably damaging 0.97
R4087:Med12l UTSW 3 59297921 missense probably benign 0.00
R4231:Med12l UTSW 3 59257223 splice site probably null
R4233:Med12l UTSW 3 59257223 splice site probably null
R4235:Med12l UTSW 3 59257223 splice site probably null
R4236:Med12l UTSW 3 59257223 splice site probably null
R4327:Med12l UTSW 3 59265267 missense probably benign 0.01
R4328:Med12l UTSW 3 59265267 missense probably benign 0.01
R4346:Med12l UTSW 3 59031555 missense probably damaging 1.00
R4543:Med12l UTSW 3 59091508 missense probably damaging 1.00
R4559:Med12l UTSW 3 59007102 critical splice donor site probably null
R4776:Med12l UTSW 3 59233212 missense probably damaging 1.00
R4877:Med12l UTSW 3 59244793 missense probably damaging 1.00
R4983:Med12l UTSW 3 59261929 missense probably damaging 1.00
R5114:Med12l UTSW 3 59259688 missense possibly damaging 0.85
R5125:Med12l UTSW 3 59267214 missense possibly damaging 0.83
R5230:Med12l UTSW 3 59245788 missense probably damaging 1.00
R5407:Med12l UTSW 3 59258201 missense probably damaging 1.00
R5426:Med12l UTSW 3 59248722 missense probably damaging 0.98
R5439:Med12l UTSW 3 59263213 missense probably null 1.00
R5449:Med12l UTSW 3 59259706 missense probably damaging 1.00
R5596:Med12l UTSW 3 59252350 missense probably benign 0.45
R5716:Med12l UTSW 3 59301377 critical splice donor site probably null
R5833:Med12l UTSW 3 59265226 missense possibly damaging 0.95
R5883:Med12l UTSW 3 59091468 missense probably damaging 1.00
R6264:Med12l UTSW 3 59256002 missense probably damaging 1.00
R6269:Med12l UTSW 3 59227822 missense probably damaging 1.00
R6394:Med12l UTSW 3 59235087 missense probably damaging 1.00
R6400:Med12l UTSW 3 59247911 missense probably damaging 1.00
R6475:Med12l UTSW 3 59257079 missense probably damaging 1.00
R6489:Med12l UTSW 3 59257407 missense probably damaging 0.99
R6654:Med12l UTSW 3 59262292 missense probably damaging 1.00
R6881:Med12l UTSW 3 59267165 missense probably benign 0.00
R7110:Med12l UTSW 3 59262224 missense not run
R7134:Med12l UTSW 3 59093759 nonsense probably null
R7137:Med12l UTSW 3 59258254 missense not run
X0062:Med12l UTSW 3 59233179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCCAGGTCTCTACGAAGCAGAAA -3'
(R):5'- GGGGTATTTGATACAATGGCAAAGAACG -3'

Sequencing Primer
(F):5'- TCTCTACGAAGCAGAAAGTGTC -3'
(R):5'- ggctggtttacaaagcagttc -3'
Posted On2014-04-13