Incidental Mutation 'R1544:Pkd1l2'
ID172027
Institutional Source Beutler Lab
Gene Symbol Pkd1l2
Ensembl Gene ENSMUSG00000034416
Gene Namepolycystic kidney disease 1 like 2
Synonyms
MMRRC Submission 039583-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1544 (G1)
Quality Score195
Status Validated
Chromosome8
Chromosomal Location116995679-117082449 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TGGG to TGG at 117038235 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098375] [ENSMUST00000109093]
Predicted Effect probably null
Transcript: ENSMUST00000098375
SMART Domains Protein: ENSMUSP00000095977
Gene: ENSMUSG00000034416

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 1.8e-18 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 510 886 1.8e-13 PFAM
low complexity region 1050 1060 N/A INTRINSIC
GPS 1278 1327 1.61e-11 SMART
transmembrane domain 1346 1365 N/A INTRINSIC
LH2 1390 1509 6.05e-13 SMART
transmembrane domain 1552 1574 N/A INTRINSIC
transmembrane domain 1589 1611 N/A INTRINSIC
transmembrane domain 1815 1837 N/A INTRINSIC
transmembrane domain 1852 1874 N/A INTRINSIC
transmembrane domain 1940 1962 N/A INTRINSIC
Pfam:PKD_channel 1980 2403 6.4e-107 PFAM
Pfam:Ion_trans 2187 2396 2.5e-12 PFAM
low complexity region 2441 2458 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109093
SMART Domains Protein: ENSMUSP00000104721
Gene: ENSMUSG00000034416

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 6.9e-19 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 519 883 7e-11 PFAM
low complexity region 1051 1061 N/A INTRINSIC
GPS 1279 1328 1.61e-11 SMART
transmembrane domain 1347 1366 N/A INTRINSIC
LH2 1391 1510 6.05e-13 SMART
transmembrane domain 1553 1575 N/A INTRINSIC
transmembrane domain 1590 1612 N/A INTRINSIC
transmembrane domain 1816 1838 N/A INTRINSIC
transmembrane domain 1853 1875 N/A INTRINSIC
transmembrane domain 1941 1963 N/A INTRINSIC
Pfam:PKD_channel 1981 2403 5.9e-106 PFAM
Pfam:Ion_trans 2138 2409 3.4e-12 PFAM
low complexity region 2442 2459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153724
Meta Mutation Damage Score 0.6372 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 86.9%
Validation Efficiency 99% (114/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578C19Rik A C X: 18,420,462 L285V possibly damaging Het
4931406B18Rik A G 7: 43,498,119 I182T possibly damaging Het
4933406P04Rik A G 10: 20,311,359 probably benign Het
4933425L06Rik A T 13: 105,109,621 H230L probably benign Het
A730018C14Rik A G 12: 112,415,490 noncoding transcript Het
Aacs A T 5: 125,516,330 I666F possibly damaging Het
Abcb9 C T 5: 124,083,631 V227I probably benign Het
Abcd3 T C 3: 121,784,473 Q168R probably benign Het
Adamts4 A G 1: 171,252,742 Q288R probably benign Het
Atad2 G A 15: 58,103,364 A611V probably damaging Het
Aup1 T C 6: 83,055,206 V118A possibly damaging Het
Bend7 T A 2: 4,763,311 probably benign Het
Brd4 A G 17: 32,198,672 probably benign Het
C4b C A 17: 34,738,967 R580L probably benign Het
Cct8 G T 16: 87,491,454 probably benign Het
Cilp T C 9: 65,275,845 Y344H probably benign Het
Clic6 A T 16: 92,492,073 probably benign Het
Colgalt2 T C 1: 152,484,952 S247P probably damaging Het
Csf2rb G T 15: 78,340,755 A212S probably benign Het
Csmd3 A C 15: 47,611,898 probably null Het
Cyp26c1 A G 19: 37,690,945 D366G probably benign Het
Dhx33 A G 11: 70,999,528 S222P probably damaging Het
Dhx40 T A 11: 86,806,553 I63F possibly damaging Het
Dlgap2 T A 8: 14,829,861 probably null Het
Dnah7b T A 1: 46,066,797 D20E unknown Het
Dnase2b C A 3: 146,584,557 A220S probably benign Het
Dock10 T C 1: 80,592,635 E362G probably benign Het
Ect2l C T 10: 18,168,434 V226I probably benign Het
Epha10 C A 4: 124,885,596 N78K probably damaging Het
Epha3 A G 16: 63,773,053 V224A probably damaging Het
Fam126a A T 5: 23,965,141 D403E probably benign Het
Fam208b A T 13: 3,590,413 H241Q possibly damaging Het
Fcgr4 C A 1: 171,019,954 D40E probably damaging Het
Fer1l4 T C 2: 156,045,633 M548V probably benign Het
Flii C T 11: 60,719,692 probably null Het
Flnc A T 6: 29,444,080 Y631F probably benign Het
Gm13101 T C 4: 143,966,062 D123G probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm4788 A T 1: 139,736,870 C484S probably damaging Het
Gm6871 A C 7: 41,546,090 probably null Het
Gtf2ird1 A T 5: 134,358,918 S1028T possibly damaging Het
Hydin A G 8: 110,574,854 H3739R probably benign Het
Iqcg A T 16: 33,045,525 N149K probably benign Het
Iqgap3 A G 3: 88,098,893 D537G probably benign Het
Itih2 T G 2: 10,105,214 D576A probably benign Het
Kcmf1 T C 6: 72,848,229 T243A probably benign Het
Kif1a A G 1: 93,074,948 probably benign Het
Klf10 C T 15: 38,296,786 G337S probably damaging Het
Krt31 T C 11: 100,047,873 N298S possibly damaging Het
Lmnb1 A G 18: 56,749,751 E556G probably benign Het
Mael A T 1: 166,202,290 S354T probably benign Het
Mast3 T C 8: 70,786,172 D496G probably damaging Het
Med12l A G 3: 59,265,240 T1806A possibly damaging Het
Mms19 A G 19: 41,955,821 probably null Het
Moap1 A T 12: 102,743,245 M15K possibly damaging Het
Mpv17l G T 16: 13,946,819 W70L probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myo7b T C 18: 31,994,909 I577V probably benign Het
Myo9b T A 8: 71,290,976 L227Q probably damaging Het
Myom2 T C 8: 15,104,059 probably benign Het
Naip6 C A 13: 100,316,475 R26L probably benign Het
Nbea T C 3: 56,058,827 T405A probably damaging Het
Nrp2 T A 1: 62,762,904 I502N probably damaging Het
Nufip2 G A 11: 77,691,907 E216K possibly damaging Het
Oaf A G 9: 43,222,633 Y264H probably damaging Het
Olfr1023 T C 2: 85,887,271 L157P probably damaging Het
Olfr643 A G 7: 104,059,224 V126A probably damaging Het
Olfr815 A T 10: 129,902,424 C95* probably null Het
Pax1 T C 2: 147,368,401 V352A probably damaging Het
Plxna3 G A X: 74,340,166 probably null Het
Pnpla3 T C 15: 84,181,046 V347A probably benign Het
Ppl T A 16: 5,102,597 K350* probably null Het
Prb1 C A 6: 132,209,460 probably null Het
Prb1 T A 6: 132,209,461 probably null Het
Ptpn11 G A 5: 121,137,511 H540Y probably benign Het
Ptprz1 C A 6: 23,000,748 H946N possibly damaging Het
Rad51b A G 12: 79,302,543 E51G possibly damaging Het
Rin2 T C 2: 145,858,446 V181A probably damaging Het
Rnf157 T A 11: 116,354,362 probably null Het
Rnf207 A G 4: 152,313,871 probably benign Het
Ror1 A T 4: 100,441,986 K852M probably damaging Het
Sbp T A 17: 23,945,069 I102K probably benign Het
Scaf8 T C 17: 3,145,154 I33T probably damaging Het
Scn5a C T 9: 119,486,633 V1670I probably damaging Het
Serhl C T 15: 83,105,676 T42M probably damaging Het
Sin3a A G 9: 57,103,997 probably benign Het
Slc12a2 A G 18: 57,879,302 S166G probably benign Het
Slc15a4 G A 5: 127,603,768 H396Y probably benign Het
Slc2a7 A T 4: 150,154,686 N123Y probably damaging Het
Smpd3 G A 8: 106,265,567 T118M possibly damaging Het
Spns2 A T 11: 72,456,367 I427N probably benign Het
Ssmem1 T A 6: 30,519,651 S112T probably damaging Het
Stard10 A T 7: 101,344,026 D190V probably damaging Het
Stil A T 4: 115,023,852 K531M probably damaging Het
Strc T C 2: 121,372,738 probably null Het
Svil T A 18: 5,046,817 I21N possibly damaging Het
Syt11 T C 3: 88,748,803 M14V probably benign Het
Tg A T 15: 66,705,232 Q1468L probably benign Het
Tjp1 A G 7: 65,302,921 V1555A probably benign Het
Tmprss11d A C 5: 86,338,799 S77R probably damaging Het
Tsnaxip1 A G 8: 105,827,751 probably benign Het
Tyr C A 7: 87,492,706 L138F probably damaging Het
Ubash3b A G 9: 41,016,605 V469A probably damaging Het
Ugt8a T C 3: 125,915,449 Y4C probably benign Het
Vmn1r201 A T 13: 22,474,798 T61S probably benign Het
Vmn1r204 A G 13: 22,556,295 H32R probably benign Het
Vmn1r228 T A 17: 20,777,023 I78L probably benign Het
Wdr90 T C 17: 25,849,310 D1348G possibly damaging Het
Zfp563 T A 17: 33,105,213 C261S probably benign Het
Zfp809 T A 9: 22,235,099 L28Q probably damaging Het
Znrf3 T A 11: 5,289,066 Q99L probably damaging Het
Other mutations in Pkd1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Pkd1l2 APN 8 117059520 nonsense probably null
IGL01353:Pkd1l2 APN 8 117057443 missense probably benign 0.24
IGL01362:Pkd1l2 APN 8 117021856 missense probably damaging 1.00
IGL01486:Pkd1l2 APN 8 117059592 missense probably benign
IGL01672:Pkd1l2 APN 8 117080732 missense possibly damaging 0.94
IGL01696:Pkd1l2 APN 8 117056387 missense probably benign 0.12
IGL01819:Pkd1l2 APN 8 116998174 missense probably damaging 1.00
IGL01833:Pkd1l2 APN 8 117060525 missense probably benign 0.00
IGL01981:Pkd1l2 APN 8 117016916 missense probably benign 0.04
IGL02066:Pkd1l2 APN 8 117009564 splice site probably benign
IGL02381:Pkd1l2 APN 8 117035800 splice site probably benign
IGL02416:Pkd1l2 APN 8 117040835 missense possibly damaging 0.82
IGL02736:Pkd1l2 APN 8 117040666 missense probably benign 0.00
IGL02828:Pkd1l2 APN 8 117029559 missense probably benign
IGL02861:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02862:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02883:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02884:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02894:Pkd1l2 APN 8 117013891 missense probably damaging 0.97
IGL02900:Pkd1l2 APN 8 117024091 missense probably benign 0.03
IGL02901:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02929:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02941:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02957:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02969:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03028:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03059:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03065:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03066:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03083:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03084:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03124:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03162:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03165:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03335:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03357:Pkd1l2 APN 8 116995809 missense probably damaging 1.00
IGL02835:Pkd1l2 UTSW 8 117065745 missense probably benign 0.07
PIT4453001:Pkd1l2 UTSW 8 117022022 missense probably benign 0.00
R0127:Pkd1l2 UTSW 8 117050048 splice site probably benign
R0309:Pkd1l2 UTSW 8 116997576 missense probably damaging 0.99
R0365:Pkd1l2 UTSW 8 117021850 missense probably benign 0.02
R0526:Pkd1l2 UTSW 8 117082260 missense probably damaging 1.00
R0571:Pkd1l2 UTSW 8 117082218 missense probably benign 0.01
R0716:Pkd1l2 UTSW 8 117051100 missense probably damaging 1.00
R0787:Pkd1l2 UTSW 8 117076177 missense possibly damaging 0.90
R0893:Pkd1l2 UTSW 8 117044492 missense probably damaging 0.99
R1256:Pkd1l2 UTSW 8 117019543 critical splice acceptor site probably null
R1391:Pkd1l2 UTSW 8 117054934 missense possibly damaging 0.87
R1474:Pkd1l2 UTSW 8 117065497 splice site probably benign
R1491:Pkd1l2 UTSW 8 117028408 missense probably damaging 1.00
R1520:Pkd1l2 UTSW 8 117046159 missense probably benign 0.00
R1521:Pkd1l2 UTSW 8 117065500 splice site probably null
R1558:Pkd1l2 UTSW 8 117082252 missense possibly damaging 0.94
R1673:Pkd1l2 UTSW 8 117040775 missense probably benign 0.00
R1691:Pkd1l2 UTSW 8 117056419 missense possibly damaging 0.60
R1754:Pkd1l2 UTSW 8 117030719 missense possibly damaging 0.81
R1857:Pkd1l2 UTSW 8 117040669 missense possibly damaging 0.70
R1939:Pkd1l2 UTSW 8 117046182 nonsense probably null
R1955:Pkd1l2 UTSW 8 117043361 missense probably benign
R1957:Pkd1l2 UTSW 8 117030682 missense probably damaging 1.00
R1959:Pkd1l2 UTSW 8 117043231 critical splice donor site probably null
R2024:Pkd1l2 UTSW 8 117019533 missense probably benign
R2046:Pkd1l2 UTSW 8 116999955 missense probably damaging 1.00
R2102:Pkd1l2 UTSW 8 117081469 missense probably damaging 0.98
R2116:Pkd1l2 UTSW 8 117030722 missense possibly damaging 0.93
R2148:Pkd1l2 UTSW 8 117056325 missense probably damaging 0.98
R2251:Pkd1l2 UTSW 8 117057438 missense probably damaging 1.00
R2252:Pkd1l2 UTSW 8 117057438 missense probably damaging 1.00
R2366:Pkd1l2 UTSW 8 117043317 missense probably benign 0.01
R2566:Pkd1l2 UTSW 8 117019494 missense probably damaging 1.00
R2872:Pkd1l2 UTSW 8 117038164 missense probably benign 0.10
R2872:Pkd1l2 UTSW 8 117038164 missense probably benign 0.10
R2985:Pkd1l2 UTSW 8 117065551 missense probably benign 0.00
R3055:Pkd1l2 UTSW 8 117068315 critical splice acceptor site probably null
R3436:Pkd1l2 UTSW 8 117040739 missense probably benign 0.01
R4732:Pkd1l2 UTSW 8 116995842 critical splice acceptor site probably null
R4733:Pkd1l2 UTSW 8 116995842 critical splice acceptor site probably null
R4763:Pkd1l2 UTSW 8 117019429 missense probably damaging 0.96
R4789:Pkd1l2 UTSW 8 117011575 missense probably damaging 0.99
R4921:Pkd1l2 UTSW 8 117054885 missense probably benign 0.03
R4921:Pkd1l2 UTSW 8 117072549 missense probably damaging 0.97
R4999:Pkd1l2 UTSW 8 117047374 splice site probably null
R5057:Pkd1l2 UTSW 8 117055008 missense probably benign 0.21
R5209:Pkd1l2 UTSW 8 117056442 missense probably benign 0.23
R5241:Pkd1l2 UTSW 8 117035118 missense probably damaging 1.00
R5480:Pkd1l2 UTSW 8 117030649 missense probably damaging 0.99
R5501:Pkd1l2 UTSW 8 117065830 missense probably damaging 0.98
R5533:Pkd1l2 UTSW 8 117068116 missense probably benign 0.03
R5582:Pkd1l2 UTSW 8 117040783 nonsense probably null
R5610:Pkd1l2 UTSW 8 117042320 missense probably benign 0.04
R5770:Pkd1l2 UTSW 8 117055018 missense probably damaging 1.00
R5854:Pkd1l2 UTSW 8 117065746 missense possibly damaging 0.48
R5867:Pkd1l2 UTSW 8 117055011 missense probably damaging 0.96
R5881:Pkd1l2 UTSW 8 116997582 missense probably damaging 0.99
R5906:Pkd1l2 UTSW 8 117029648 missense probably damaging 1.00
R5909:Pkd1l2 UTSW 8 117024056 missense probably benign 0.00
R6030:Pkd1l2 UTSW 8 117043237 missense probably damaging 1.00
R6030:Pkd1l2 UTSW 8 117043237 missense probably damaging 1.00
R6084:Pkd1l2 UTSW 8 117013987 missense probably damaging 1.00
R6122:Pkd1l2 UTSW 8 117082368 missense probably benign 0.02
R6216:Pkd1l2 UTSW 8 117081470 missense probably damaging 1.00
R6406:Pkd1l2 UTSW 8 117035847 missense probably damaging 0.99
R6417:Pkd1l2 UTSW 8 117013899 missense probably damaging 1.00
R6420:Pkd1l2 UTSW 8 117013899 missense probably damaging 1.00
R6601:Pkd1l2 UTSW 8 117040666 missense probably benign 0.00
R6743:Pkd1l2 UTSW 8 117030631 missense probably damaging 1.00
R7053:Pkd1l2 UTSW 8 117013942 missense probably damaging 1.00
R7144:Pkd1l2 UTSW 8 117076131 nonsense probably null
R7148:Pkd1l2 UTSW 8 117080786 missense probably benign 0.00
R7169:Pkd1l2 UTSW 8 117040835 missense possibly damaging 0.82
R7217:Pkd1l2 UTSW 8 116995797 missense probably benign 0.24
R7310:Pkd1l2 UTSW 8 117024034 missense probably benign
R7382:Pkd1l2 UTSW 8 117054871 missense possibly damaging 0.95
R7397:Pkd1l2 UTSW 8 117035902 missense possibly damaging 0.94
R7408:Pkd1l2 UTSW 8 117028479 missense possibly damaging 0.77
R7437:Pkd1l2 UTSW 8 117030682 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGACCTCACCTTAGCCTGATCCTG -3'
(R):5'- TAGCCAGTCagccagagtcttgtg -3'

Sequencing Primer
(F):5'- ACCTTAGCCTGATCCTGTATGTC -3'
(R):5'- ccagttacatccccagcc -3'
Posted On2014-04-13