Incidental Mutation 'R1545:Abca2'
ID172087
Institutional Source Beutler Lab
Gene Symbol Abca2
Ensembl Gene ENSMUSG00000026944
Gene NameATP-binding cassette, sub-family A (ABC1), member 2
SynonymsAbc2, D2H0S1474E
MMRRC Submission 039584-MU
Accession Numbers

NCBI RefSeq: NM_007379.2; MGI: 99606

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1545 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25428703-25448540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25442358 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 1468 (C1468R)
Ref Sequence ENSEMBL: ENSMUSP00000099983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102919]
Predicted Effect probably benign
Transcript: ENSMUST00000102919
AA Change: C1468R

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099983
Gene: ENSMUSG00000026944
AA Change: C1468R

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
coiled coil region 271 296 N/A INTRINSIC
low complexity region 309 346 N/A INTRINSIC
Pfam:ABC2_membrane_3 493 911 9.7e-18 PFAM
AAA 1015 1197 9.22e-7 SMART
low complexity region 1364 1376 N/A INTRINSIC
low complexity region 1589 1607 N/A INTRINSIC
Pfam:ABC2_membrane_3 1696 2008 2.3e-44 PFAM
AAA 2079 2264 1.12e-5 SMART
low complexity region 2375 2394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141065
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199405
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype Strain: 3697467; 3719855
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is highly expressed in brain tissue and may play a role in macrophage lipid metabolism and neural development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mice show tremors, hyperactivity, abnormal coordination, and alterations in CNS myelin sheath ultrastructure, [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik C A 5: 98,329,432 Q27K probably benign Het
Aaas C T 15: 102,339,206 R410H probably damaging Het
Actl9 T A 17: 33,433,257 I97N probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asb3 T A 11: 31,056,217 M234K probably benign Het
Bax A C 7: 45,461,933 H168Q probably null Het
Brinp1 A G 4: 68,762,955 L446P possibly damaging Het
Cdc14a A G 3: 116,293,724 probably null Het
Cpq A T 15: 33,250,000 I168F probably damaging Het
Crkl A T 16: 17,483,692 N270I probably damaging Het
Cul7 G A 17: 46,651,553 E37K probably damaging Het
Eps15 C T 4: 109,312,329 T112I probably benign Het
F5 C T 1: 164,208,960 R1897* probably null Het
Fam160a1 C T 3: 85,665,954 S896N probably damaging Het
Fbxl5 A T 5: 43,770,798 L40Q probably damaging Het
Gm884 T C 11: 103,608,919 K615E probably benign Het
Gprc5a C A 6: 135,083,461 T316K probably damaging Het
Hectd4 T A 5: 121,323,956 L2299Q possibly damaging Het
Khdc3 C G 9: 73,103,660 P240R probably benign Het
Kif20b A G 19: 34,928,918 T69A probably damaging Het
Kptn C G 7: 16,123,963 Q239E probably benign Het
Lep T C 6: 29,070,832 S52P probably damaging Het
Lrig3 G A 10: 126,008,547 V627M possibly damaging Het
Mdga1 G A 17: 29,842,902 R792C probably damaging Het
Mink1 T C 11: 70,598,891 V58A possibly damaging Het
Neu1 G A 17: 34,934,398 R299Q probably benign Het
Nrg3 T A 14: 38,407,154 I375F probably benign Het
Nup50 A G 15: 84,939,792 T449A possibly damaging Het
Nup98 A G 7: 102,134,880 S1082P possibly damaging Het
Olfr904 C A 9: 38,464,519 H159Q probably benign Het
Otub1 T C 19: 7,199,206 I188V probably benign Het
Pcdhac2 T C 18: 37,146,133 I722T possibly damaging Het
Pcsk7 T A 9: 45,914,348 D292E probably damaging Het
Peli2 T A 14: 48,252,717 D215E probably benign Het
Ppp1r9a T C 6: 5,156,242 probably null Het
Ppp2r1b A G 9: 50,862,425 K136R possibly damaging Het
Prpf3 T C 3: 95,847,803 K157E probably damaging Het
Prss50 T C 9: 110,861,268 S160P probably damaging Het
Ptprb T C 10: 116,380,869 V2251A probably damaging Het
Rgs6 G A 12: 83,116,177 E386K probably damaging Het
Rida A G 15: 34,495,104 I5T probably benign Het
Rpe A G 1: 66,701,010 H35R probably damaging Het
Sema4b T A 7: 80,219,023 D321E probably benign Het
Slc22a13 G A 9: 119,209,047 A5V probably benign Het
Snta1 C T 2: 154,377,006 probably null Het
Spdye4c T A 2: 128,595,712 N220K probably benign Het
Sult1c1 G T 17: 53,962,148 A280E possibly damaging Het
Tfr2 A G 5: 137,583,299 E579G probably benign Het
Tmem221 A G 8: 71,558,538 L91P probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Vmn1r17 A G 6: 57,361,332 V16A probably benign Het
Vmn1r188 A G 13: 22,088,433 R186G probably damaging Het
Wfikkn1 A G 17: 25,878,591 V253A probably damaging Het
Other mutations in Abca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Abca2 APN 2 25445963 splice site probably null
IGL01102:Abca2 APN 2 25433956 splice site probably benign
IGL01322:Abca2 APN 2 25446782 splice site probably null
IGL01402:Abca2 APN 2 25442003 missense probably damaging 1.00
IGL01419:Abca2 APN 2 25437514 missense probably damaging 1.00
IGL01490:Abca2 APN 2 25446011 missense probably damaging 1.00
IGL01633:Abca2 APN 2 25444394 missense possibly damaging 0.66
IGL01661:Abca2 APN 2 25442995 missense probably benign 0.01
IGL01804:Abca2 APN 2 25446625 missense probably damaging 1.00
IGL01933:Abca2 APN 2 25444111 missense probably damaging 1.00
IGL01941:Abca2 APN 2 25443095 missense probably benign 0.02
IGL02158:Abca2 APN 2 25447879 utr 3 prime probably benign
IGL02173:Abca2 APN 2 25441897 missense probably benign 0.00
IGL02419:Abca2 APN 2 25446837 missense probably benign
IGL02532:Abca2 APN 2 25435136 missense probably benign 0.03
IGL02572:Abca2 APN 2 25433317 missense possibly damaging 0.95
Abseiling UTSW 2 25447003 missense possibly damaging 0.65
R0126:Abca2 UTSW 2 25443730 missense possibly damaging 0.88
R0140:Abca2 UTSW 2 25438085 critical splice donor site probably null
R0372:Abca2 UTSW 2 25437353 missense probably damaging 1.00
R0437:Abca2 UTSW 2 25442845 missense probably damaging 0.99
R0505:Abca2 UTSW 2 25434894 missense probably benign 0.22
R0570:Abca2 UTSW 2 25447405 splice site probably null
R1037:Abca2 UTSW 2 25438228 splice site probably benign
R1283:Abca2 UTSW 2 25446689 missense probably damaging 1.00
R1448:Abca2 UTSW 2 25440530 missense possibly damaging 0.73
R1464:Abca2 UTSW 2 25447834 splice site probably benign
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1480:Abca2 UTSW 2 25433397 missense possibly damaging 0.60
R1562:Abca2 UTSW 2 25446319 missense probably benign 0.43
R1569:Abca2 UTSW 2 25439185 missense probably benign 0.45
R1586:Abca2 UTSW 2 25447216 missense probably damaging 0.98
R1635:Abca2 UTSW 2 25444856 missense probably benign 0.03
R1699:Abca2 UTSW 2 25447351 missense possibly damaging 0.80
R1754:Abca2 UTSW 2 25434333 missense probably benign 0.01
R1760:Abca2 UTSW 2 25443043 missense probably benign 0.00
R2040:Abca2 UTSW 2 25443805 missense probably damaging 1.00
R2067:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2111:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2248:Abca2 UTSW 2 25433464 splice site probably benign
R2323:Abca2 UTSW 2 25445175 missense probably benign 0.00
R2418:Abca2 UTSW 2 25437989 missense probably benign 0.22
R2419:Abca2 UTSW 2 25437989 missense probably benign 0.22
R3816:Abca2 UTSW 2 25446071 missense probably damaging 1.00
R4180:Abca2 UTSW 2 25441578 missense possibly damaging 0.58
R4431:Abca2 UTSW 2 25442852 missense probably benign
R4468:Abca2 UTSW 2 25444902 missense probably damaging 1.00
R4704:Abca2 UTSW 2 25443412 missense probably damaging 0.99
R4839:Abca2 UTSW 2 25440909 missense probably damaging 0.99
R4933:Abca2 UTSW 2 25444827 missense probably benign 0.25
R4970:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R4971:Abca2 UTSW 2 25441994 missense probably damaging 0.97
R5112:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R5327:Abca2 UTSW 2 25445674 missense probably damaging 1.00
R5378:Abca2 UTSW 2 25446068 missense probably damaging 1.00
R5648:Abca2 UTSW 2 25436498 critical splice donor site probably null
R5725:Abca2 UTSW 2 25439400 missense probably damaging 0.98
R5825:Abca2 UTSW 2 25436736 missense probably benign 0.36
R5837:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5840:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5851:Abca2 UTSW 2 25442310 missense possibly damaging 0.58
R6262:Abca2 UTSW 2 25444910 missense possibly damaging 0.56
R6344:Abca2 UTSW 2 25437694 missense probably damaging 1.00
R6547:Abca2 UTSW 2 25433338 missense possibly damaging 0.80
R6640:Abca2 UTSW 2 25447003 missense possibly damaging 0.65
R6980:Abca2 UTSW 2 25440866 missense possibly damaging 0.89
R6981:Abca2 UTSW 2 25444139 missense probably damaging 1.00
R7070:Abca2 UTSW 2 25442995 missense probably benign 0.06
R7080:Abca2 UTSW 2 25446104 missense not run
Predicted Primers PCR Primer
(F):5'- TCAGCTTACAAGGTGGAAGCCAATG -3'
(R):5'- TGCAGTTATCTGATGCCAGCCC -3'

Sequencing Primer
(F):5'- GGGACTGGCTATTTACCTCTGC -3'
(R):5'- GATGACTCCTAAGGAGACAGATCC -3'
Posted On2014-04-13