Incidental Mutation 'R1545:Eps15'
ID172096
Institutional Source Beutler Lab
Gene Symbol Eps15
Ensembl Gene ENSMUSG00000028552
Gene Nameepidermal growth factor receptor pathway substrate 15
Synonyms
MMRRC Submission 039584-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1545 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location109280268-109387817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109312329 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 112 (T112I)
Ref Sequence ENSEMBL: ENSMUSP00000118949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102729] [ENSMUST00000132165] [ENSMUST00000175776] [ENSMUST00000176251] [ENSMUST00000177089]
Predicted Effect probably benign
Transcript: ENSMUST00000102729
AA Change: T112I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099790
Gene: ENSMUSG00000028552
AA Change: T112I

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 502 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
internal_repeat_2 622 655 1.25e-5 PROSPERO
low complexity region 662 685 N/A INTRINSIC
low complexity region 744 754 N/A INTRINSIC
low complexity region 774 792 N/A INTRINSIC
internal_repeat_2 799 831 1.25e-5 PROSPERO
UIM 852 871 3.32e0 SMART
UIM 878 897 1.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132165
AA Change: T112I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000118949
Gene: ENSMUSG00000028552
AA Change: T112I

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 429 N/A INTRINSIC
low complexity region 529 552 N/A INTRINSIC
low complexity region 611 621 N/A INTRINSIC
low complexity region 641 659 N/A INTRINSIC
UIM 719 738 3.32e0 SMART
UIM 745 764 1.55e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141751
Predicted Effect probably benign
Transcript: ENSMUST00000175776
AA Change: T112I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135270
Gene: ENSMUSG00000028552
AA Change: T112I

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 253 349 4.38e-48 SMART
EFh 263 291 1.2e1 SMART
EFh 297 325 6.82e1 SMART
coiled coil region 365 538 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
internal_repeat_2 658 691 1.92e-5 PROSPERO
low complexity region 698 721 N/A INTRINSIC
low complexity region 780 790 N/A INTRINSIC
low complexity region 810 828 N/A INTRINSIC
internal_repeat_2 835 867 1.92e-5 PROSPERO
UIM 888 907 3.32e0 SMART
UIM 914 933 1.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176251
AA Change: T112I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135034
Gene: ENSMUSG00000028552
AA Change: T112I

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 502 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 662 685 N/A INTRINSIC
low complexity region 744 754 N/A INTRINSIC
low complexity region 774 791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177089
AA Change: T80I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134922
Gene: ENSMUSG00000028552
AA Change: T80I

DomainStartEndE-ValueType
SCOP:d1qjta_ 4 69 4e-5 SMART
PDB:1QJT|A 15 72 9e-36 PDB
Blast:EH 15 84 3e-39 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of the EGFR pathway. The protein is present at clatherin-coated pits and is involved in receptor-mediated endocytosis of EGF. Notably, this gene is rearranged with the HRX/ALL/MLL gene in acute myelogeneous leukemias. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for a null allele show increased marginal zone B cell number with no changes in precursor cells, proliferation, apoptosis, migration or B cell responses. Homozygotes for a different null allele show decreased mean corpuscular hemoglobin (MCH), decreased MCH concentration, and dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik C A 5: 98,329,432 Q27K probably benign Het
Aaas C T 15: 102,339,206 R410H probably damaging Het
Abca2 T C 2: 25,442,358 C1468R probably benign Het
Actl9 T A 17: 33,433,257 I97N probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asb3 T A 11: 31,056,217 M234K probably benign Het
Bax A C 7: 45,461,933 H168Q probably null Het
Brinp1 A G 4: 68,762,955 L446P possibly damaging Het
Cdc14a A G 3: 116,293,724 probably null Het
Cpq A T 15: 33,250,000 I168F probably damaging Het
Crkl A T 16: 17,483,692 N270I probably damaging Het
Cul7 G A 17: 46,651,553 E37K probably damaging Het
F5 C T 1: 164,208,960 R1897* probably null Het
Fam160a1 C T 3: 85,665,954 S896N probably damaging Het
Fbxl5 A T 5: 43,770,798 L40Q probably damaging Het
Gm884 T C 11: 103,608,919 K615E probably benign Het
Gprc5a C A 6: 135,083,461 T316K probably damaging Het
Hectd4 T A 5: 121,323,956 L2299Q possibly damaging Het
Khdc3 C G 9: 73,103,660 P240R probably benign Het
Kif20b A G 19: 34,928,918 T69A probably damaging Het
Kptn C G 7: 16,123,963 Q239E probably benign Het
Lep T C 6: 29,070,832 S52P probably damaging Het
Lrig3 G A 10: 126,008,547 V627M possibly damaging Het
Mdga1 G A 17: 29,842,902 R792C probably damaging Het
Mink1 T C 11: 70,598,891 V58A possibly damaging Het
Neu1 G A 17: 34,934,398 R299Q probably benign Het
Nrg3 T A 14: 38,407,154 I375F probably benign Het
Nup50 A G 15: 84,939,792 T449A possibly damaging Het
Nup98 A G 7: 102,134,880 S1082P possibly damaging Het
Olfr904 C A 9: 38,464,519 H159Q probably benign Het
Otub1 T C 19: 7,199,206 I188V probably benign Het
Pcdhac2 T C 18: 37,146,133 I722T possibly damaging Het
Pcsk7 T A 9: 45,914,348 D292E probably damaging Het
Peli2 T A 14: 48,252,717 D215E probably benign Het
Ppp1r9a T C 6: 5,156,242 probably null Het
Ppp2r1b A G 9: 50,862,425 K136R possibly damaging Het
Prpf3 T C 3: 95,847,803 K157E probably damaging Het
Prss50 T C 9: 110,861,268 S160P probably damaging Het
Ptprb T C 10: 116,380,869 V2251A probably damaging Het
Rgs6 G A 12: 83,116,177 E386K probably damaging Het
Rida A G 15: 34,495,104 I5T probably benign Het
Rpe A G 1: 66,701,010 H35R probably damaging Het
Sema4b T A 7: 80,219,023 D321E probably benign Het
Slc22a13 G A 9: 119,209,047 A5V probably benign Het
Snta1 C T 2: 154,377,006 probably null Het
Spdye4c T A 2: 128,595,712 N220K probably benign Het
Sult1c1 G T 17: 53,962,148 A280E possibly damaging Het
Tfr2 A G 5: 137,583,299 E579G probably benign Het
Tmem221 A G 8: 71,558,538 L91P probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Vmn1r17 A G 6: 57,361,332 V16A probably benign Het
Vmn1r188 A G 13: 22,088,433 R186G probably damaging Het
Wfikkn1 A G 17: 25,878,591 V253A probably damaging Het
Other mutations in Eps15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Eps15 APN 4 109309149 missense probably damaging 0.99
IGL01372:Eps15 APN 4 109322106 missense probably damaging 1.00
IGL01642:Eps15 APN 4 109366473 missense probably benign 0.00
IGL02207:Eps15 APN 4 109304748 splice site probably benign
IGL02394:Eps15 APN 4 109312965 missense probably damaging 1.00
IGL02755:Eps15 APN 4 109329698 missense probably benign 0.17
R0117:Eps15 UTSW 4 109382819 missense probably damaging 0.96
R0414:Eps15 UTSW 4 109366480 missense probably damaging 0.96
R0928:Eps15 UTSW 4 109312963 missense possibly damaging 0.95
R1581:Eps15 UTSW 4 109363186 missense probably benign 0.15
R1627:Eps15 UTSW 4 109370557 missense probably damaging 1.00
R1756:Eps15 UTSW 4 109312918 nonsense probably null
R1799:Eps15 UTSW 4 109382837 missense probably damaging 1.00
R1906:Eps15 UTSW 4 109324201 missense possibly damaging 0.89
R1916:Eps15 UTSW 4 109368974 missense probably damaging 1.00
R2042:Eps15 UTSW 4 109304767 missense probably damaging 0.98
R2046:Eps15 UTSW 4 109370596 missense probably damaging 1.00
R2163:Eps15 UTSW 4 109370669 missense probably damaging 0.98
R2213:Eps15 UTSW 4 109361220 missense probably damaging 1.00
R2362:Eps15 UTSW 4 109361230 missense probably benign 0.06
R3151:Eps15 UTSW 4 109366222 missense probably benign 0.02
R3712:Eps15 UTSW 4 109309177 missense probably damaging 1.00
R3727:Eps15 UTSW 4 109370685 splice site probably benign
R4361:Eps15 UTSW 4 109380031 critical splice donor site probably null
R4381:Eps15 UTSW 4 109366530 unclassified probably benign
R4466:Eps15 UTSW 4 109366530 unclassified probably benign
R4740:Eps15 UTSW 4 109343190 missense probably damaging 1.00
R4797:Eps15 UTSW 4 109366530 unclassified probably benign
R4799:Eps15 UTSW 4 109366530 unclassified probably benign
R4801:Eps15 UTSW 4 109324217 missense possibly damaging 0.95
R4802:Eps15 UTSW 4 109324217 missense possibly damaging 0.95
R4864:Eps15 UTSW 4 109366530 unclassified probably benign
R4954:Eps15 UTSW 4 109370678 splice site probably null
R5134:Eps15 UTSW 4 109366530 unclassified probably benign
R5386:Eps15 UTSW 4 109321225 missense possibly damaging 0.48
R5768:Eps15 UTSW 4 109363176 splice site probably null
R5870:Eps15 UTSW 4 109361310 missense probably damaging 0.98
R6245:Eps15 UTSW 4 109382866 missense possibly damaging 0.66
R6290:Eps15 UTSW 4 109363198 missense probably benign 0.37
R6291:Eps15 UTSW 4 109305703 frame shift probably null
R6493:Eps15 UTSW 4 109368948 missense probably damaging 1.00
R6813:Eps15 UTSW 4 109280402 utr 5 prime probably null
R6885:Eps15 UTSW 4 109309164 missense probably damaging 0.99
R6913:Eps15 UTSW 4 109361230 missense probably benign 0.06
R7362:Eps15 UTSW 4 109366242 critical splice donor site probably null
R7461:Eps15 UTSW 4 109329725 missense probably damaging 1.00
X0023:Eps15 UTSW 4 109343357 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTGCTGCCGTTAGGTATCATGACAA -3'
(R):5'- TCTCTAAGAGCTAAGGCATTCCTCAAGT -3'

Sequencing Primer
(F):5'- TTCCCCCGGTAATACTGAGG -3'
(R):5'- AGGCATTCCTCAAGTTTTTTAATTTC -3'
Posted On2014-04-13