Incidental Mutation 'R1546:D630045J12Rik'
ID172174
Institutional Source Beutler Lab
Gene Symbol D630045J12Rik
Ensembl Gene ENSMUSG00000063455
Gene NameRIKEN cDNA D630045J12 gene
Synonyms
MMRRC Submission 039585-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1546 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location38123174-38254009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38190655 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1004 (I1004T)
Ref Sequence ENSEMBL: ENSMUSP00000130121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117556] [ENSMUST00000169256]
Predicted Effect probably damaging
Transcript: ENSMUST00000117556
AA Change: I863T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112939
Gene: ENSMUSG00000063455
AA Change: I863T

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 414 431 N/A INTRINSIC
low complexity region 528 573 N/A INTRINSIC
low complexity region 581 598 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
Pfam:DUF3827 746 1412 N/A PFAM
low complexity region 1480 1500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149557
Predicted Effect probably damaging
Transcript: ENSMUST00000169256
AA Change: I1004T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130121
Gene: ENSMUSG00000063455
AA Change: I1004T

DomainStartEndE-ValueType
signal peptide 1 45 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
low complexity region 693 710 N/A INTRINSIC
low complexity region 807 852 N/A INTRINSIC
low complexity region 860 877 N/A INTRINSIC
transmembrane domain 987 1009 N/A INTRINSIC
Pfam:DUF3827 1026 1691 7.1e-301 PFAM
low complexity region 1759 1779 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UPF0606 family. This gene has been found to be fused to the BRAF oncogene in many cases of pilocytic astrocytoma. The fusion results from 2Mb tandem duplications at 7q34. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,941,775 S251P probably damaging Het
4931409K22Rik A T 5: 24,555,428 probably null Het
4932438A13Rik T C 3: 36,870,056 V10A possibly damaging Het
Aaas C A 15: 102,346,718 R79L probably benign Het
Acap2 C A 16: 31,104,936 E657* probably null Het
Adgrg5 A T 8: 94,941,630 E441V probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
AY358078 C T 14: 51,820,419 probably null Het
Bco2 A G 9: 50,550,629 V25A possibly damaging Het
Carf T A 1: 60,126,036 probably null Het
Ccdc38 A T 10: 93,565,879 I134L probably benign Het
Cgnl1 A G 9: 71,725,815 S85P probably benign Het
Ctsl A G 13: 64,367,879 V126A probably damaging Het
Cwc27 A C 13: 104,802,185 S206A probably damaging Het
Dgki A G 6: 37,050,203 V401A probably damaging Het
Dpp8 C T 9: 65,063,493 H545Y possibly damaging Het
Dpy19l1 A T 9: 24,475,384 C205S probably damaging Het
Enpp2 C T 15: 54,845,829 E797K probably benign Het
Ephb2 C T 4: 136,771,009 R253H probably damaging Het
Esrra T C 19: 6,920,297 T31A probably benign Het
Ewsr1 C A 11: 5,078,574 probably benign Het
Flt4 G T 11: 49,631,981 R475L probably benign Het
Gm13547 A G 2: 29,763,909 E138G possibly damaging Het
Gm572 A T 4: 148,666,819 R216S possibly damaging Het
Hapln2 T A 3: 88,024,097 Y37F probably benign Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,766 probably benign Het
Hhla1 C T 15: 65,933,327 A369T probably benign Het
Hist1h2ae A G 13: 23,570,945 V55A probably damaging Het
Hmg20a T A 9: 56,467,401 F14I possibly damaging Het
Itga2 A T 13: 114,849,420 S940T possibly damaging Het
Kcnt2 A G 1: 140,431,378 N377S probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx6 A G 2: 36,091,037 S298P probably benign Het
Lrp2 C T 2: 69,502,610 G1521D probably damaging Het
Mogat2 A G 7: 99,232,559 W57R probably damaging Het
Ms4a3 T C 19: 11,632,907 N97S probably benign Het
Myo1a A G 10: 127,712,624 D380G probably damaging Het
Nufip2 T A 11: 77,691,606 D115E probably damaging Het
Ogn A T 13: 49,609,333 K50N probably benign Het
Olfr202 T C 16: 59,284,003 R165G probably damaging Het
Olfr250 A T 9: 38,367,548 M1L probably benign Het
Pde8b G A 13: 95,046,443 T269I probably damaging Het
Ppargc1b A T 18: 61,310,606 D495E probably damaging Het
Prdm16 C A 4: 154,528,660 K103N possibly damaging Het
Proc C T 18: 32,127,410 G221S probably damaging Het
Pxk A G 14: 8,164,091 N561S probably damaging Het
Rapgef5 A G 12: 117,647,101 N323S probably benign Het
Slc6a13 T G 6: 121,332,374 D281E possibly damaging Het
Slc8a1 T C 17: 81,648,247 Y454C probably damaging Het
Sntg2 C A 12: 30,288,296 L115F probably damaging Het
Spata13 A G 14: 60,756,408 D1103G probably damaging Het
Supv3l1 G A 10: 62,432,446 A540V probably benign Het
Tet1 A T 10: 62,812,910 D1914E probably damaging Het
Tmem30a A G 9: 79,771,288 *329Q probably null Het
Tspan5 A T 3: 138,898,341 L162F probably damaging Het
Ttn T A 2: 76,719,052 K31760N probably damaging Het
Tyr A T 7: 87,437,992 D437E probably benign Het
Ubr4 T A 4: 139,416,927 L1427* probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vcan A G 13: 89,692,956 S1490P probably damaging Het
Vcl T A 14: 21,008,950 C545S probably damaging Het
Vmn2r4 C T 3: 64,406,888 G224D probably damaging Het
Vmn2r97 T A 17: 18,947,848 V788E probably damaging Het
Vrtn G A 12: 84,648,508 V11M probably damaging Het
Zbtb21 A T 16: 97,952,027 V380D probably damaging Het
Zcchc14 G A 8: 121,604,263 probably benign Het
Other mutations in D630045J12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:D630045J12Rik APN 6 38194930 missense probably benign 0.03
IGL01089:D630045J12Rik APN 6 38136963 missense probably benign
IGL01745:D630045J12Rik APN 6 38191720 missense probably damaging 0.99
IGL02069:D630045J12Rik APN 6 38184072 missense probably damaging 0.98
IGL02238:D630045J12Rik APN 6 38196394 missense probably benign
IGL02496:D630045J12Rik APN 6 38149705 missense probably damaging 1.00
IGL02675:D630045J12Rik APN 6 38195485 missense possibly damaging 0.93
IGL03030:D630045J12Rik APN 6 38149713 missense probably damaging 1.00
IGL03203:D630045J12Rik APN 6 38168221 missense probably damaging 0.98
IGL03205:D630045J12Rik APN 6 38147259 missense probably damaging 1.00
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0128:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0130:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0206:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0208:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0347:D630045J12Rik UTSW 6 38181392 missense probably damaging 0.97
R0396:D630045J12Rik UTSW 6 38196736 missense possibly damaging 0.85
R0538:D630045J12Rik UTSW 6 38191693 missense probably damaging 1.00
R0636:D630045J12Rik UTSW 6 38196778 missense probably benign
R0842:D630045J12Rik UTSW 6 38148465 missense probably damaging 1.00
R1120:D630045J12Rik UTSW 6 38194770 missense probably damaging 0.96
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1412:D630045J12Rik UTSW 6 38195760 missense probably benign 0.03
R1649:D630045J12Rik UTSW 6 38181431 missense probably damaging 0.98
R1704:D630045J12Rik UTSW 6 38139427 missense probably benign 0.14
R1969:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R1971:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R2182:D630045J12Rik UTSW 6 38174147 critical splice donor site probably null
R2354:D630045J12Rik UTSW 6 38158091 missense possibly damaging 0.88
R2926:D630045J12Rik UTSW 6 38168171 missense probably damaging 1.00
R3768:D630045J12Rik UTSW 6 38142909 missense probably damaging 1.00
R3886:D630045J12Rik UTSW 6 38142698 missense possibly damaging 0.90
R4439:D630045J12Rik UTSW 6 38194761 missense probably benign 0.07
R4688:D630045J12Rik UTSW 6 38196657 missense possibly damaging 0.85
R4739:D630045J12Rik UTSW 6 38196036 missense possibly damaging 0.76
R4748:D630045J12Rik UTSW 6 38196841 missense possibly damaging 0.91
R4792:D630045J12Rik UTSW 6 38148340 missense probably damaging 1.00
R4794:D630045J12Rik UTSW 6 38194485 missense possibly damaging 0.90
R4947:D630045J12Rik UTSW 6 38148543 missense probably damaging 1.00
R4959:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R4973:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R5261:D630045J12Rik UTSW 6 38194620 missense probably benign
R5344:D630045J12Rik UTSW 6 38158228 missense probably damaging 1.00
R5488:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5489:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5605:D630045J12Rik UTSW 6 38191764 missense probably damaging 1.00
R5828:D630045J12Rik UTSW 6 38196367 missense possibly damaging 0.47
R5831:D630045J12Rik UTSW 6 38142657 missense possibly damaging 0.80
R5939:D630045J12Rik UTSW 6 38194969 missense possibly damaging 0.70
R6021:D630045J12Rik UTSW 6 38190617 missense probably benign 0.05
R6060:D630045J12Rik UTSW 6 38130864 missense probably damaging 1.00
R6081:D630045J12Rik UTSW 6 38142698 missense probably damaging 0.99
R6498:D630045J12Rik UTSW 6 38147197 nonsense probably null
R6930:D630045J12Rik UTSW 6 38158216 missense probably damaging 1.00
R7019:D630045J12Rik UTSW 6 38194635 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AAACTACAAGCTCAGGTCCAGACCA -3'
(R):5'- CTTCAGTTTCCCATAATTCACTATTCAACCCA -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- CACTATTCAACCCATAGTATGGTCTG -3'
Posted On2014-04-13