Incidental Mutation 'R1546:Supv3l1'
List |< first << previous [record 53 of 67] next >> last >|
ID172189
Institutional Source Beutler Lab
Gene Symbol Supv3l1
Ensembl Gene ENSMUSG00000020079
Gene Namesuppressor of var1, 3-like 1 (S. cerevisiae)
Synonyms
MMRRC Submission 039585-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1546 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62429209-62449738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62432446 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 540 (A540V)
Ref Sequence ENSEMBL: ENSMUSP00000020273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020273]
Predicted Effect probably benign
Transcript: ENSMUST00000020273
AA Change: A540V

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020273
Gene: ENSMUSG00000020079
AA Change: A540V

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 47 56 N/A INTRINSIC
HELICc 379 475 1.44e-18 SMART
Pfam:SUV3_C 625 672 4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161941
Predicted Effect probably benign
Transcript: ENSMUST00000162023
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit embryonic lethality between E9.5 and E12.5. Mice homozygous for a knock-out allele exhibit embryonic lethality between E8.5 and 9.5. Mice heterozygous for this allele produce offspring with mitochondrial defects regardless of offspring genotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,941,775 S251P probably damaging Het
4931409K22Rik A T 5: 24,555,428 probably null Het
4932438A13Rik T C 3: 36,870,056 V10A possibly damaging Het
Aaas C A 15: 102,346,718 R79L probably benign Het
Acap2 C A 16: 31,104,936 E657* probably null Het
Adgrg5 A T 8: 94,941,630 E441V probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
AY358078 C T 14: 51,820,419 probably null Het
Bco2 A G 9: 50,550,629 V25A possibly damaging Het
Carf T A 1: 60,126,036 probably null Het
Ccdc38 A T 10: 93,565,879 I134L probably benign Het
Cgnl1 A G 9: 71,725,815 S85P probably benign Het
Ctsl A G 13: 64,367,879 V126A probably damaging Het
Cwc27 A C 13: 104,802,185 S206A probably damaging Het
D630045J12Rik A G 6: 38,190,655 I1004T probably damaging Het
Dgki A G 6: 37,050,203 V401A probably damaging Het
Dpp8 C T 9: 65,063,493 H545Y possibly damaging Het
Dpy19l1 A T 9: 24,475,384 C205S probably damaging Het
Enpp2 C T 15: 54,845,829 E797K probably benign Het
Ephb2 C T 4: 136,771,009 R253H probably damaging Het
Esrra T C 19: 6,920,297 T31A probably benign Het
Ewsr1 C A 11: 5,078,574 probably benign Het
Flt4 G T 11: 49,631,981 R475L probably benign Het
Gm13547 A G 2: 29,763,909 E138G possibly damaging Het
Gm572 A T 4: 148,666,819 R216S possibly damaging Het
Hapln2 T A 3: 88,024,097 Y37F probably benign Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,766 probably benign Het
Hhla1 C T 15: 65,933,327 A369T probably benign Het
Hist1h2ae A G 13: 23,570,945 V55A probably damaging Het
Hmg20a T A 9: 56,467,401 F14I possibly damaging Het
Itga2 A T 13: 114,849,420 S940T possibly damaging Het
Kcnt2 A G 1: 140,431,378 N377S probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx6 A G 2: 36,091,037 S298P probably benign Het
Lrp2 C T 2: 69,502,610 G1521D probably damaging Het
Mogat2 A G 7: 99,232,559 W57R probably damaging Het
Ms4a3 T C 19: 11,632,907 N97S probably benign Het
Myo1a A G 10: 127,712,624 D380G probably damaging Het
Nufip2 T A 11: 77,691,606 D115E probably damaging Het
Ogn A T 13: 49,609,333 K50N probably benign Het
Olfr202 T C 16: 59,284,003 R165G probably damaging Het
Olfr250 A T 9: 38,367,548 M1L probably benign Het
Pde8b G A 13: 95,046,443 T269I probably damaging Het
Ppargc1b A T 18: 61,310,606 D495E probably damaging Het
Prdm16 C A 4: 154,528,660 K103N possibly damaging Het
Proc C T 18: 32,127,410 G221S probably damaging Het
Pxk A G 14: 8,164,091 N561S probably damaging Het
Rapgef5 A G 12: 117,647,101 N323S probably benign Het
Slc6a13 T G 6: 121,332,374 D281E possibly damaging Het
Slc8a1 T C 17: 81,648,247 Y454C probably damaging Het
Sntg2 C A 12: 30,288,296 L115F probably damaging Het
Spata13 A G 14: 60,756,408 D1103G probably damaging Het
Tet1 A T 10: 62,812,910 D1914E probably damaging Het
Tmem30a A G 9: 79,771,288 *329Q probably null Het
Tspan5 A T 3: 138,898,341 L162F probably damaging Het
Ttn T A 2: 76,719,052 K31760N probably damaging Het
Tyr A T 7: 87,437,992 D437E probably benign Het
Ubr4 T A 4: 139,416,927 L1427* probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vcan A G 13: 89,692,956 S1490P probably damaging Het
Vcl T A 14: 21,008,950 C545S probably damaging Het
Vmn2r4 C T 3: 64,406,888 G224D probably damaging Het
Vmn2r97 T A 17: 18,947,848 V788E probably damaging Het
Vrtn G A 12: 84,648,508 V11M probably damaging Het
Zbtb21 A T 16: 97,952,027 V380D probably damaging Het
Zcchc14 G A 8: 121,604,263 probably benign Het
Other mutations in Supv3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03067:Supv3l1 APN 10 62429821 missense probably damaging 1.00
R0090:Supv3l1 UTSW 10 62429706 missense probably benign 0.00
R0477:Supv3l1 UTSW 10 62430585 missense probably damaging 0.98
R0946:Supv3l1 UTSW 10 62429820 missense probably damaging 1.00
R1460:Supv3l1 UTSW 10 62443383 splice site probably benign
R1941:Supv3l1 UTSW 10 62449612 missense probably benign
R3916:Supv3l1 UTSW 10 62449420 missense possibly damaging 0.67
R5030:Supv3l1 UTSW 10 62430615 missense probably damaging 1.00
R5040:Supv3l1 UTSW 10 62447065 missense possibly damaging 0.93
R5051:Supv3l1 UTSW 10 62443417 missense probably damaging 0.99
R5085:Supv3l1 UTSW 10 62435512 missense probably benign 0.00
R5288:Supv3l1 UTSW 10 62430596 missense possibly damaging 0.90
R5359:Supv3l1 UTSW 10 62432399 missense probably damaging 0.96
R5372:Supv3l1 UTSW 10 62432357 missense probably damaging 0.99
R5384:Supv3l1 UTSW 10 62430596 missense possibly damaging 0.90
R5385:Supv3l1 UTSW 10 62430596 missense possibly damaging 0.90
R5527:Supv3l1 UTSW 10 62429829 missense probably damaging 1.00
R5602:Supv3l1 UTSW 10 62430592 missense possibly damaging 0.81
R5713:Supv3l1 UTSW 10 62430504 missense possibly damaging 0.91
R6150:Supv3l1 UTSW 10 62435722 missense possibly damaging 0.90
R6220:Supv3l1 UTSW 10 62439021 missense possibly damaging 0.82
R6903:Supv3l1 UTSW 10 62441237 missense probably damaging 1.00
R6941:Supv3l1 UTSW 10 62430586 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGCAACAGCTCAAAGTAGCATGGAG -3'
(R):5'- TGAGGTAGGTCCGCTGGGATTAAAG -3'

Sequencing Primer
(F):5'- TGGAGCTAAAGACATACCTGTAAC -3'
(R):5'- ggctgtcctggaactcac -3'
Posted On2014-04-13