Incidental Mutation 'R1546:Vcl'
ID172209
Institutional Source Beutler Lab
Gene Symbol Vcl
Ensembl Gene ENSMUSG00000021823
Gene Namevinculin
Synonymsmetavinculin
MMRRC Submission 039585-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1546 (G1)
Quality Score212
Status Not validated
Chromosome14
Chromosomal Location20929398-21033676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21008950 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 545 (C545S)
Ref Sequence ENSEMBL: ENSMUSP00000022369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022369]
Predicted Effect probably damaging
Transcript: ENSMUST00000022369
AA Change: C545S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022369
Gene: ENSMUSG00000021823
AA Change: C545S

DomainStartEndE-ValueType
Pfam:Vinculin 3 485 9e-203 PFAM
Pfam:Vinculin 475 1066 1.7e-301 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vinculin is a cytoskeletal protein associated with cell-cell and cell-matrix junctions, where it is thought to function as one of several interacting proteins involved in anchoring F-actin to the membrane. Defects in VCL are the cause of cardiomyopathy dilated type 1W. Dilated cardiomyopathy is a disorder characterized by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die by embryonic day 10 with failed midline fusion of the rostral neural tube, bilobular cranial development and compromised cranial and spinal nerve development. Abnormal myocardial and endocardial structures are seen in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,941,775 S251P probably damaging Het
4931409K22Rik A T 5: 24,555,428 probably null Het
4932438A13Rik T C 3: 36,870,056 V10A possibly damaging Het
Aaas C A 15: 102,346,718 R79L probably benign Het
Acap2 C A 16: 31,104,936 E657* probably null Het
Adgrg5 A T 8: 94,941,630 E441V probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
AY358078 C T 14: 51,820,419 probably null Het
Bco2 A G 9: 50,550,629 V25A possibly damaging Het
Carf T A 1: 60,126,036 probably null Het
Ccdc38 A T 10: 93,565,879 I134L probably benign Het
Cgnl1 A G 9: 71,725,815 S85P probably benign Het
Ctsl A G 13: 64,367,879 V126A probably damaging Het
Cwc27 A C 13: 104,802,185 S206A probably damaging Het
D630045J12Rik A G 6: 38,190,655 I1004T probably damaging Het
Dgki A G 6: 37,050,203 V401A probably damaging Het
Dpp8 C T 9: 65,063,493 H545Y possibly damaging Het
Dpy19l1 A T 9: 24,475,384 C205S probably damaging Het
Enpp2 C T 15: 54,845,829 E797K probably benign Het
Ephb2 C T 4: 136,771,009 R253H probably damaging Het
Esrra T C 19: 6,920,297 T31A probably benign Het
Ewsr1 C A 11: 5,078,574 probably benign Het
Flt4 G T 11: 49,631,981 R475L probably benign Het
Gm13547 A G 2: 29,763,909 E138G possibly damaging Het
Gm572 A T 4: 148,666,819 R216S possibly damaging Het
Hapln2 T A 3: 88,024,097 Y37F probably benign Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,766 probably benign Het
Hhla1 C T 15: 65,933,327 A369T probably benign Het
Hist1h2ae A G 13: 23,570,945 V55A probably damaging Het
Hmg20a T A 9: 56,467,401 F14I possibly damaging Het
Itga2 A T 13: 114,849,420 S940T possibly damaging Het
Kcnt2 A G 1: 140,431,378 N377S probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx6 A G 2: 36,091,037 S298P probably benign Het
Lrp2 C T 2: 69,502,610 G1521D probably damaging Het
Mogat2 A G 7: 99,232,559 W57R probably damaging Het
Ms4a3 T C 19: 11,632,907 N97S probably benign Het
Myo1a A G 10: 127,712,624 D380G probably damaging Het
Nufip2 T A 11: 77,691,606 D115E probably damaging Het
Ogn A T 13: 49,609,333 K50N probably benign Het
Olfr202 T C 16: 59,284,003 R165G probably damaging Het
Olfr250 A T 9: 38,367,548 M1L probably benign Het
Pde8b G A 13: 95,046,443 T269I probably damaging Het
Ppargc1b A T 18: 61,310,606 D495E probably damaging Het
Prdm16 C A 4: 154,528,660 K103N possibly damaging Het
Proc C T 18: 32,127,410 G221S probably damaging Het
Pxk A G 14: 8,164,091 N561S probably damaging Het
Rapgef5 A G 12: 117,647,101 N323S probably benign Het
Slc6a13 T G 6: 121,332,374 D281E possibly damaging Het
Slc8a1 T C 17: 81,648,247 Y454C probably damaging Het
Sntg2 C A 12: 30,288,296 L115F probably damaging Het
Spata13 A G 14: 60,756,408 D1103G probably damaging Het
Supv3l1 G A 10: 62,432,446 A540V probably benign Het
Tet1 A T 10: 62,812,910 D1914E probably damaging Het
Tmem30a A G 9: 79,771,288 *329Q probably null Het
Tspan5 A T 3: 138,898,341 L162F probably damaging Het
Ttn T A 2: 76,719,052 K31760N probably damaging Het
Tyr A T 7: 87,437,992 D437E probably benign Het
Ubr4 T A 4: 139,416,927 L1427* probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vcan A G 13: 89,692,956 S1490P probably damaging Het
Vmn2r4 C T 3: 64,406,888 G224D probably damaging Het
Vmn2r97 T A 17: 18,947,848 V788E probably damaging Het
Vrtn G A 12: 84,648,508 V11M probably damaging Het
Zbtb21 A T 16: 97,952,027 V380D probably damaging Het
Zcchc14 G A 8: 121,604,263 probably benign Het
Other mutations in Vcl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Vcl APN 14 20987003 missense probably benign 0.00
IGL01755:Vcl APN 14 20995970 missense probably damaging 0.99
IGL01994:Vcl APN 14 21003243 missense probably damaging 1.00
IGL02128:Vcl APN 14 21020577 missense probably benign
IGL02168:Vcl APN 14 21007287 missense probably benign 0.21
IGL02502:Vcl APN 14 21019385 missense probably damaging 1.00
IGL02574:Vcl APN 14 20929575 nonsense probably null
IGL03103:Vcl APN 14 21024280 missense probably damaging 1.00
IGL03046:Vcl UTSW 14 21022017 missense possibly damaging 0.52
R0137:Vcl UTSW 14 20987015 nonsense probably null
R0320:Vcl UTSW 14 20985624 splice site probably benign
R1442:Vcl UTSW 14 20983378 missense probably damaging 1.00
R1692:Vcl UTSW 14 21024182 missense probably damaging 0.99
R1709:Vcl UTSW 14 21019373 missense probably benign 0.03
R1737:Vcl UTSW 14 21020536 missense probably damaging 1.00
R1848:Vcl UTSW 14 21008995 missense probably benign 0.03
R1902:Vcl UTSW 14 20982699 missense probably damaging 1.00
R4623:Vcl UTSW 14 21014939 missense probably benign 0.33
R4654:Vcl UTSW 14 20985752 splice site probably null
R5084:Vcl UTSW 14 21008959 missense possibly damaging 0.54
R5168:Vcl UTSW 14 21010102 missense probably damaging 1.00
R5275:Vcl UTSW 14 21010078 missense probably damaging 1.00
R6637:Vcl UTSW 14 21003132 missense probably damaging 1.00
R6859:Vcl UTSW 14 20987075 missense probably damaging 1.00
X0028:Vcl UTSW 14 20985662 nonsense probably null
X0060:Vcl UTSW 14 21020776 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CTGCTCATTGGGAAGAATGGGAGTC -3'
(R):5'- AAATCTCAAGCCTCAGGCCAAGATG -3'

Sequencing Primer
(F):5'- CCCCAAAAGTTAGTGCATAGTG -3'
(R):5'- tcccagaacaatgagatgcc -3'
Posted On2014-04-13