Incidental Mutation 'R1546:Hhla1'
ID172213
Institutional Source Beutler Lab
Gene Symbol Hhla1
Ensembl Gene ENSMUSG00000072511
Gene NameHERV-H LTR-associating 1
SynonymsF930104E18Rik
MMRRC Submission 039585-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R1546 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location65922443-65976804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65933327 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 369 (A369T)
Ref Sequence ENSEMBL: ENSMUSP00000098149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100584]
Predicted Effect probably benign
Transcript: ENSMUST00000100584
AA Change: A369T

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000098149
Gene: ENSMUSG00000072511
AA Change: A369T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173338
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,941,775 S251P probably damaging Het
4931409K22Rik A T 5: 24,555,428 probably null Het
4932438A13Rik T C 3: 36,870,056 V10A possibly damaging Het
Aaas C A 15: 102,346,718 R79L probably benign Het
Acap2 C A 16: 31,104,936 E657* probably null Het
Adgrg5 A T 8: 94,941,630 E441V probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
AY358078 C T 14: 51,820,419 probably null Het
Bco2 A G 9: 50,550,629 V25A possibly damaging Het
Carf T A 1: 60,126,036 probably null Het
Ccdc38 A T 10: 93,565,879 I134L probably benign Het
Cgnl1 A G 9: 71,725,815 S85P probably benign Het
Ctsl A G 13: 64,367,879 V126A probably damaging Het
Cwc27 A C 13: 104,802,185 S206A probably damaging Het
D630045J12Rik A G 6: 38,190,655 I1004T probably damaging Het
Dgki A G 6: 37,050,203 V401A probably damaging Het
Dpp8 C T 9: 65,063,493 H545Y possibly damaging Het
Dpy19l1 A T 9: 24,475,384 C205S probably damaging Het
Enpp2 C T 15: 54,845,829 E797K probably benign Het
Ephb2 C T 4: 136,771,009 R253H probably damaging Het
Esrra T C 19: 6,920,297 T31A probably benign Het
Ewsr1 C A 11: 5,078,574 probably benign Het
Flt4 G T 11: 49,631,981 R475L probably benign Het
Gm13547 A G 2: 29,763,909 E138G possibly damaging Het
Gm572 A T 4: 148,666,819 R216S possibly damaging Het
Hapln2 T A 3: 88,024,097 Y37F probably benign Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,766 probably benign Het
Hist1h2ae A G 13: 23,570,945 V55A probably damaging Het
Hmg20a T A 9: 56,467,401 F14I possibly damaging Het
Itga2 A T 13: 114,849,420 S940T possibly damaging Het
Kcnt2 A G 1: 140,431,378 N377S probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx6 A G 2: 36,091,037 S298P probably benign Het
Lrp2 C T 2: 69,502,610 G1521D probably damaging Het
Mogat2 A G 7: 99,232,559 W57R probably damaging Het
Ms4a3 T C 19: 11,632,907 N97S probably benign Het
Myo1a A G 10: 127,712,624 D380G probably damaging Het
Nufip2 T A 11: 77,691,606 D115E probably damaging Het
Ogn A T 13: 49,609,333 K50N probably benign Het
Olfr202 T C 16: 59,284,003 R165G probably damaging Het
Olfr250 A T 9: 38,367,548 M1L probably benign Het
Pde8b G A 13: 95,046,443 T269I probably damaging Het
Ppargc1b A T 18: 61,310,606 D495E probably damaging Het
Prdm16 C A 4: 154,528,660 K103N possibly damaging Het
Proc C T 18: 32,127,410 G221S probably damaging Het
Pxk A G 14: 8,164,091 N561S probably damaging Het
Rapgef5 A G 12: 117,647,101 N323S probably benign Het
Slc6a13 T G 6: 121,332,374 D281E possibly damaging Het
Slc8a1 T C 17: 81,648,247 Y454C probably damaging Het
Sntg2 C A 12: 30,288,296 L115F probably damaging Het
Spata13 A G 14: 60,756,408 D1103G probably damaging Het
Supv3l1 G A 10: 62,432,446 A540V probably benign Het
Tet1 A T 10: 62,812,910 D1914E probably damaging Het
Tmem30a A G 9: 79,771,288 *329Q probably null Het
Tspan5 A T 3: 138,898,341 L162F probably damaging Het
Ttn T A 2: 76,719,052 K31760N probably damaging Het
Tyr A T 7: 87,437,992 D437E probably benign Het
Ubr4 T A 4: 139,416,927 L1427* probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vcan A G 13: 89,692,956 S1490P probably damaging Het
Vcl T A 14: 21,008,950 C545S probably damaging Het
Vmn2r4 C T 3: 64,406,888 G224D probably damaging Het
Vmn2r97 T A 17: 18,947,848 V788E probably damaging Het
Vrtn G A 12: 84,648,508 V11M probably damaging Het
Zbtb21 A T 16: 97,952,027 V380D probably damaging Het
Zcchc14 G A 8: 121,604,263 probably benign Het
Other mutations in Hhla1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Hhla1 APN 15 65941961 missense probably damaging 1.00
IGL02531:Hhla1 APN 15 65967407 splice site probably benign
IGL02609:Hhla1 APN 15 65930614 splice site probably benign
IGL02948:Hhla1 APN 15 65942693 missense probably damaging 1.00
IGL03063:Hhla1 APN 15 65941790 missense probably damaging 1.00
IGL03411:Hhla1 APN 15 65930229 critical splice donor site probably null
P4717OSA:Hhla1 UTSW 15 65924001 missense probably damaging 0.99
R0277:Hhla1 UTSW 15 65948503 missense probably benign 0.01
R0323:Hhla1 UTSW 15 65948503 missense probably benign 0.01
R0492:Hhla1 UTSW 15 65936291 missense probably benign
R2039:Hhla1 UTSW 15 65936377 missense possibly damaging 0.75
R2112:Hhla1 UTSW 15 65936383 missense probably benign 0.00
R2405:Hhla1 UTSW 15 65936311 nonsense probably null
R4804:Hhla1 UTSW 15 65923099 missense probably benign 0.01
R5512:Hhla1 UTSW 15 65924016 missense probably benign 0.00
R5651:Hhla1 UTSW 15 65941814 missense probably damaging 1.00
R6012:Hhla1 UTSW 15 65948490 missense probably damaging 1.00
R6237:Hhla1 UTSW 15 65941797 missense probably damaging 1.00
R6837:Hhla1 UTSW 15 65948485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCATACAaggaaacccagtggag -3'
(R):5'- CACATGATCAAGGAGATCAAGTACAGCAA -3'

Sequencing Primer
(F):5'- gaggagaaggagacaaggaag -3'
(R):5'- CAGCAATACTAATGGTTGTCCC -3'
Posted On2014-04-13