Incidental Mutation 'R1546:Aaas'
ID172215
Institutional Source Beutler Lab
Gene Symbol Aaas
Ensembl Gene ENSMUSG00000036678
Gene Nameachalasia, adrenocortical insufficiency, alacrimia
SynonymsD030041N15Rik, GL003, Aladin
MMRRC Submission 039585-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R1546 (G1)
Quality Score136
Status Not validated
Chromosome15
Chromosomal Location102338252-102350771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 102346718 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 79 (R79L)
Ref Sequence ENSEMBL: ENSMUSP00000155527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041208] [ENSMUST00000229900] [ENSMUST00000230481] [ENSMUST00000231061]
Predicted Effect probably benign
Transcript: ENSMUST00000041208
AA Change: R120L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044604
Gene: ENSMUSG00000036678
AA Change: R120L

DomainStartEndE-ValueType
WD40 136 179 3.7e0 SMART
WD40 181 221 4.75e1 SMART
WD40 232 273 1.17e-5 SMART
WD40 278 315 2.66e0 SMART
Blast:WD40 319 357 2e-15 BLAST
low complexity region 534 545 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229589
Predicted Effect probably benign
Transcript: ENSMUST00000229900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230349
Predicted Effect probably benign
Transcript: ENSMUST00000230481
AA Change: R79L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230812
Predicted Effect probably benign
Transcript: ENSMUST00000231061
AA Change: R120L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD-repeat family of regulatory proteins and may be involved in normal development of the peripheral and central nervous system. The encoded protein is part of the nuclear pore complex and is anchored there by NDC1. Defects in this gene are a cause of achalasia-addisonianism-alacrima syndrome (AAAS), also called triple-A syndrome or Allgrove syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mice display female infertility, mildly decreased exploratory behavior, and decreased body weight, but have normal adrenocortical function and do not develop severe neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,941,775 S251P probably damaging Het
4931409K22Rik A T 5: 24,555,428 probably null Het
4932438A13Rik T C 3: 36,870,056 V10A possibly damaging Het
Acap2 C A 16: 31,104,936 E657* probably null Het
Adgrg5 A T 8: 94,941,630 E441V probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
AY358078 C T 14: 51,820,419 probably null Het
Bco2 A G 9: 50,550,629 V25A possibly damaging Het
Carf T A 1: 60,126,036 probably null Het
Ccdc38 A T 10: 93,565,879 I134L probably benign Het
Cgnl1 A G 9: 71,725,815 S85P probably benign Het
Ctsl A G 13: 64,367,879 V126A probably damaging Het
Cwc27 A C 13: 104,802,185 S206A probably damaging Het
D630045J12Rik A G 6: 38,190,655 I1004T probably damaging Het
Dgki A G 6: 37,050,203 V401A probably damaging Het
Dpp8 C T 9: 65,063,493 H545Y possibly damaging Het
Dpy19l1 A T 9: 24,475,384 C205S probably damaging Het
Enpp2 C T 15: 54,845,829 E797K probably benign Het
Ephb2 C T 4: 136,771,009 R253H probably damaging Het
Esrra T C 19: 6,920,297 T31A probably benign Het
Ewsr1 C A 11: 5,078,574 probably benign Het
Flt4 G T 11: 49,631,981 R475L probably benign Het
Gm13547 A G 2: 29,763,909 E138G possibly damaging Het
Gm572 A T 4: 148,666,819 R216S possibly damaging Het
Hapln2 T A 3: 88,024,097 Y37F probably benign Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,766 probably benign Het
Hhla1 C T 15: 65,933,327 A369T probably benign Het
Hist1h2ae A G 13: 23,570,945 V55A probably damaging Het
Hmg20a T A 9: 56,467,401 F14I possibly damaging Het
Itga2 A T 13: 114,849,420 S940T possibly damaging Het
Kcnt2 A G 1: 140,431,378 N377S probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx6 A G 2: 36,091,037 S298P probably benign Het
Lrp2 C T 2: 69,502,610 G1521D probably damaging Het
Mogat2 A G 7: 99,232,559 W57R probably damaging Het
Ms4a3 T C 19: 11,632,907 N97S probably benign Het
Myo1a A G 10: 127,712,624 D380G probably damaging Het
Nufip2 T A 11: 77,691,606 D115E probably damaging Het
Ogn A T 13: 49,609,333 K50N probably benign Het
Olfr202 T C 16: 59,284,003 R165G probably damaging Het
Olfr250 A T 9: 38,367,548 M1L probably benign Het
Pde8b G A 13: 95,046,443 T269I probably damaging Het
Ppargc1b A T 18: 61,310,606 D495E probably damaging Het
Prdm16 C A 4: 154,528,660 K103N possibly damaging Het
Proc C T 18: 32,127,410 G221S probably damaging Het
Pxk A G 14: 8,164,091 N561S probably damaging Het
Rapgef5 A G 12: 117,647,101 N323S probably benign Het
Slc6a13 T G 6: 121,332,374 D281E possibly damaging Het
Slc8a1 T C 17: 81,648,247 Y454C probably damaging Het
Sntg2 C A 12: 30,288,296 L115F probably damaging Het
Spata13 A G 14: 60,756,408 D1103G probably damaging Het
Supv3l1 G A 10: 62,432,446 A540V probably benign Het
Tet1 A T 10: 62,812,910 D1914E probably damaging Het
Tmem30a A G 9: 79,771,288 *329Q probably null Het
Tspan5 A T 3: 138,898,341 L162F probably damaging Het
Ttn T A 2: 76,719,052 K31760N probably damaging Het
Tyr A T 7: 87,437,992 D437E probably benign Het
Ubr4 T A 4: 139,416,927 L1427* probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vcan A G 13: 89,692,956 S1490P probably damaging Het
Vcl T A 14: 21,008,950 C545S probably damaging Het
Vmn2r4 C T 3: 64,406,888 G224D probably damaging Het
Vmn2r97 T A 17: 18,947,848 V788E probably damaging Het
Vrtn G A 12: 84,648,508 V11M probably damaging Het
Zbtb21 A T 16: 97,952,027 V380D probably damaging Het
Zcchc14 G A 8: 121,604,263 probably benign Het
Other mutations in Aaas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Aaas APN 15 102339374 missense possibly damaging 0.77
IGL01620:Aaas APN 15 102339950 missense probably damaging 1.00
IGL02337:Aaas APN 15 102339227 missense probably benign 0.01
IGL02608:Aaas APN 15 102339192 missense probably benign 0.00
IGL03024:Aaas APN 15 102350491 splice site probably benign
IGL03217:Aaas APN 15 102349995 missense probably damaging 1.00
IGL03273:Aaas APN 15 102349995 missense probably damaging 1.00
Shrinker UTSW 15 102346676 critical splice donor site probably null
R1545:Aaas UTSW 15 102339206 missense probably damaging 1.00
R1957:Aaas UTSW 15 102338633 unclassified probably benign
R1996:Aaas UTSW 15 102340059 missense probably benign 0.10
R1997:Aaas UTSW 15 102340059 missense probably benign 0.10
R3079:Aaas UTSW 15 102340444 missense probably damaging 0.99
R3715:Aaas UTSW 15 102340336 missense probably benign 0.01
R5427:Aaas UTSW 15 102339950 missense possibly damaging 0.94
R5586:Aaas UTSW 15 102346676 critical splice donor site probably null
R5620:Aaas UTSW 15 102338391 missense probably benign 0.00
R5969:Aaas UTSW 15 102350564 missense probably damaging 1.00
R6763:Aaas UTSW 15 102340022 missense probably null
Predicted Primers PCR Primer
(F):5'- TCCCCAAAGGCATTTTCAGTTCAGG -3'
(R):5'- TGGGAGATGGTATCCAAGCCCATTC -3'

Sequencing Primer
(F):5'- GGCATTTTCAGTTCAGGAATCC -3'
(R):5'- GGTATCCAAGCCCATTCATTGC -3'
Posted On2014-04-13