Incidental Mutation 'R1546:Olfr202'
ID172218
Institutional Source Beutler Lab
Gene Symbol Olfr202
Ensembl Gene ENSMUSG00000048810
Gene Nameolfactory receptor 202
SynonymsMOR182-1, GA_x54KRFPKG5P-55498766-55497843
MMRRC Submission 039585-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R1546 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location59283516-59286793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59284003 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 165 (R165G)
Ref Sequence ENSEMBL: ENSMUSP00000151058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049859] [ENSMUST00000201687] [ENSMUST00000217485]
Predicted Effect probably damaging
Transcript: ENSMUST00000049859
AA Change: R165G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000059496
Gene: ENSMUSG00000048810
AA Change: R165G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.9e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 296 1.9e-6 PFAM
Pfam:7tm_1 41 290 1.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201687
AA Change: R165G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144622
Gene: ENSMUSG00000048810
AA Change: R165G

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 3.4e-46 PFAM
Pfam:7tm_1 40 289 1.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217485
AA Change: R165G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,941,775 S251P probably damaging Het
4931409K22Rik A T 5: 24,555,428 probably null Het
4932438A13Rik T C 3: 36,870,056 V10A possibly damaging Het
Aaas C A 15: 102,346,718 R79L probably benign Het
Acap2 C A 16: 31,104,936 E657* probably null Het
Adgrg5 A T 8: 94,941,630 E441V probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
AY358078 C T 14: 51,820,419 probably null Het
Bco2 A G 9: 50,550,629 V25A possibly damaging Het
Carf T A 1: 60,126,036 probably null Het
Ccdc38 A T 10: 93,565,879 I134L probably benign Het
Cgnl1 A G 9: 71,725,815 S85P probably benign Het
Ctsl A G 13: 64,367,879 V126A probably damaging Het
Cwc27 A C 13: 104,802,185 S206A probably damaging Het
D630045J12Rik A G 6: 38,190,655 I1004T probably damaging Het
Dgki A G 6: 37,050,203 V401A probably damaging Het
Dpp8 C T 9: 65,063,493 H545Y possibly damaging Het
Dpy19l1 A T 9: 24,475,384 C205S probably damaging Het
Enpp2 C T 15: 54,845,829 E797K probably benign Het
Ephb2 C T 4: 136,771,009 R253H probably damaging Het
Esrra T C 19: 6,920,297 T31A probably benign Het
Ewsr1 C A 11: 5,078,574 probably benign Het
Flt4 G T 11: 49,631,981 R475L probably benign Het
Gm13547 A G 2: 29,763,909 E138G possibly damaging Het
Gm572 A T 4: 148,666,819 R216S possibly damaging Het
Hapln2 T A 3: 88,024,097 Y37F probably benign Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,766 probably benign Het
Hhla1 C T 15: 65,933,327 A369T probably benign Het
Hist1h2ae A G 13: 23,570,945 V55A probably damaging Het
Hmg20a T A 9: 56,467,401 F14I possibly damaging Het
Itga2 A T 13: 114,849,420 S940T possibly damaging Het
Kcnt2 A G 1: 140,431,378 N377S probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx6 A G 2: 36,091,037 S298P probably benign Het
Lrp2 C T 2: 69,502,610 G1521D probably damaging Het
Mogat2 A G 7: 99,232,559 W57R probably damaging Het
Ms4a3 T C 19: 11,632,907 N97S probably benign Het
Myo1a A G 10: 127,712,624 D380G probably damaging Het
Nufip2 T A 11: 77,691,606 D115E probably damaging Het
Ogn A T 13: 49,609,333 K50N probably benign Het
Olfr250 A T 9: 38,367,548 M1L probably benign Het
Pde8b G A 13: 95,046,443 T269I probably damaging Het
Ppargc1b A T 18: 61,310,606 D495E probably damaging Het
Prdm16 C A 4: 154,528,660 K103N possibly damaging Het
Proc C T 18: 32,127,410 G221S probably damaging Het
Pxk A G 14: 8,164,091 N561S probably damaging Het
Rapgef5 A G 12: 117,647,101 N323S probably benign Het
Slc6a13 T G 6: 121,332,374 D281E possibly damaging Het
Slc8a1 T C 17: 81,648,247 Y454C probably damaging Het
Sntg2 C A 12: 30,288,296 L115F probably damaging Het
Spata13 A G 14: 60,756,408 D1103G probably damaging Het
Supv3l1 G A 10: 62,432,446 A540V probably benign Het
Tet1 A T 10: 62,812,910 D1914E probably damaging Het
Tmem30a A G 9: 79,771,288 *329Q probably null Het
Tspan5 A T 3: 138,898,341 L162F probably damaging Het
Ttn T A 2: 76,719,052 K31760N probably damaging Het
Tyr A T 7: 87,437,992 D437E probably benign Het
Ubr4 T A 4: 139,416,927 L1427* probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vcan A G 13: 89,692,956 S1490P probably damaging Het
Vcl T A 14: 21,008,950 C545S probably damaging Het
Vmn2r4 C T 3: 64,406,888 G224D probably damaging Het
Vmn2r97 T A 17: 18,947,848 V788E probably damaging Het
Vrtn G A 12: 84,648,508 V11M probably damaging Het
Zbtb21 A T 16: 97,952,027 V380D probably damaging Het
Zcchc14 G A 8: 121,604,263 probably benign Het
Other mutations in Olfr202
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Olfr202 APN 16 59284221 missense probably damaging 0.99
IGL02439:Olfr202 APN 16 59284455 missense probably damaging 1.00
IGL02798:Olfr202 APN 16 59284115 nonsense probably null
IGL03075:Olfr202 APN 16 59283928 missense possibly damaging 0.87
IGL03186:Olfr202 APN 16 59283903 missense probably damaging 0.98
R0270:Olfr202 UTSW 16 59283753 missense probably damaging 1.00
R0631:Olfr202 UTSW 16 59284207 missense possibly damaging 0.60
R1441:Olfr202 UTSW 16 59283865 missense probably benign 0.00
R3403:Olfr202 UTSW 16 59284112 missense probably benign 0.09
R4790:Olfr202 UTSW 16 59284458 missense probably damaging 0.99
R4960:Olfr202 UTSW 16 59283985 missense probably benign 0.23
R5369:Olfr202 UTSW 16 59284380 missense probably damaging 0.97
R5419:Olfr202 UTSW 16 59284341 missense probably damaging 0.99
R5646:Olfr202 UTSW 16 59283979 missense probably benign 0.00
R6048:Olfr202 UTSW 16 59283979 missense probably benign 0.00
R6732:Olfr202 UTSW 16 59283951 missense probably benign 0.16
R6994:Olfr202 UTSW 16 59284090 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TCTCAGAATGGCAAAGAGCACACG -3'
(R):5'- ATCTGGAAGGACCCTCATCTCCAC -3'

Sequencing Primer
(F):5'- CGGGTATAGGAGACTACAATATTTGC -3'
(R):5'- CAGATCATGAGATATCCCTGGTTGAG -3'
Posted On2014-04-13