Incidental Mutation 'R1548:Pabpc1l'
ID172307
Institutional Source Beutler Lab
Gene Symbol Pabpc1l
Ensembl Gene ENSMUSG00000054582
Gene Namepoly(A) binding protein, cytoplasmic 1-like
Synonyms1810053B01Rik, ePAB
MMRRC Submission 039587-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1548 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164025450-164050538 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 164037171 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 313 (V313F)
Ref Sequence ENSEMBL: ENSMUSP00000096701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067715]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067715
AA Change: V313F

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096701
Gene: ENSMUSG00000054582
AA Change: V313F

DomainStartEndE-ValueType
RRM 12 85 2.3e-23 SMART
RRM 100 171 1.84e-22 SMART
RRM 192 264 2.31e-28 SMART
RRM 295 366 7.07e-24 SMART
SCOP:d1g9la_ 425 478 1e-6 SMART
PolyA 535 598 8.33e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156087
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (69/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired oocyte maturation and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik T C 9: 41,581,376 L116P probably damaging Het
A830018L16Rik A T 1: 11,518,594 R78S probably damaging Het
Acad10 G T 5: 121,626,040 probably benign Het
Acad10 G C 5: 121,626,041 probably benign Het
Ang2 C A 14: 51,195,533 E131* probably null Het
Ankfn1 T C 11: 89,526,541 N82D probably damaging Het
Anks1b T C 10: 90,049,985 I181T possibly damaging Het
Bcl2l12 C G 7: 44,992,818 G215R probably damaging Het
Bnc2 A G 4: 84,275,957 Y1044H probably damaging Het
Cacna1s T C 1: 136,110,937 F1172S probably damaging Het
Cct8 A G 16: 87,485,584 I482T probably damaging Het
Cfap74 C T 4: 155,434,045 T580I probably benign Het
Cib1 A T 7: 80,228,414 Y105* probably null Het
Cpa1 G A 6: 30,642,335 G245D probably damaging Het
Csmd3 A G 15: 47,981,975 V801A possibly damaging Het
Ddx10 T C 9: 53,149,561 probably null Het
Ddx4 T C 13: 112,599,997 N613S probably damaging Het
Drd3 A G 16: 43,821,341 D340G probably benign Het
E2f4 A G 8: 105,304,688 *411W probably null Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Foxp1 A T 6: 98,945,420 I450N probably damaging Het
Gm10229 G A 16: 89,015,389 probably benign Het
Gm5771 G T 6: 41,396,011 L72F probably damaging Het
Gm813 A T 16: 58,615,839 D40E probably benign Het
Gpr19 A G 6: 134,870,084 F175S possibly damaging Het
Gpr21 C T 2: 37,518,072 T210M probably damaging Het
Grhl2 C T 15: 37,336,323 A488V probably benign Het
Hif3a T C 7: 17,044,403 T435A probably benign Het
Hoxb4 C T 11: 96,318,899 R44* probably null Het
Ifi47 A G 11: 49,095,871 D155G probably damaging Het
Igdcc4 T C 9: 65,135,227 L142P probably benign Het
Ints6 G A 14: 62,713,692 P296L probably damaging Het
Itga3 A G 11: 95,046,919 probably null Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lgals12 A T 19: 7,604,312 H50Q probably benign Het
Lrp12 A G 15: 39,872,506 S696P probably damaging Het
Lrp6 G A 6: 134,459,429 T1258I possibly damaging Het
Meis2 C T 2: 116,058,702 D190N probably damaging Het
Mon2 C T 10: 123,036,007 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Muc6 A G 7: 141,652,103 probably benign Het
Myo15 A G 11: 60,488,238 H1394R probably damaging Het
Myo5a A T 9: 75,171,746 I929F probably damaging Het
Nek6 T A 2: 38,568,895 Y141N probably damaging Het
Notch4 T A 17: 34,568,422 C319S probably damaging Het
Nwd2 A T 5: 63,800,182 D285V probably benign Het
Olfml1 T C 7: 107,590,375 S216P possibly damaging Het
Pfkfb2 G T 1: 130,698,083 H453Q probably benign Het
Pigt C T 2: 164,501,519 T305I probably benign Het
Plxnb1 C T 9: 109,100,900 L275F possibly damaging Het
Ppm1d C T 11: 85,339,605 R350C probably damaging Het
Rassf1 C A 9: 107,551,846 P84T probably benign Het
Rgl3 G T 9: 21,980,706 R361S probably benign Het
Rnf213 G A 11: 119,442,707 R2914H probably damaging Het
Ryr2 A T 13: 11,554,549 C4956* probably null Het
Scaper C T 9: 55,816,670 R668H probably damaging Het
Spata6 T C 4: 111,779,006 F165L probably benign Het
Tcirg1 A T 19: 3,896,845 W694R probably benign Het
Tmem245 A T 4: 56,906,233 Y160* probably null Het
Tshr T C 12: 91,534,031 Y279H probably damaging Het
Ttf1 A C 2: 29,065,138 K171N probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Xdh A G 17: 73,913,901 V611A probably damaging Het
Zfp142 G T 1: 74,570,104 H1408N probably damaging Het
Other mutations in Pabpc1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Pabpc1l APN 2 164042317 missense probably damaging 1.00
IGL00911:Pabpc1l APN 2 164042423 missense probably damaging 1.00
IGL02096:Pabpc1l APN 2 164044347 missense probably benign 0.00
IGL02198:Pabpc1l APN 2 164027616 missense probably damaging 0.97
IGL02534:Pabpc1l APN 2 164027490 missense probably damaging 1.00
IGL02684:Pabpc1l APN 2 164031277 missense probably benign
R0371:Pabpc1l UTSW 2 164035272 missense probably benign 0.08
R0799:Pabpc1l UTSW 2 164031214 missense probably benign
R1202:Pabpc1l UTSW 2 164037171 missense possibly damaging 0.74
R1203:Pabpc1l UTSW 2 164037171 missense possibly damaging 0.74
R1549:Pabpc1l UTSW 2 164037171 missense possibly damaging 0.74
R1687:Pabpc1l UTSW 2 164044306 missense probably benign 0.00
R1928:Pabpc1l UTSW 2 164032254 missense possibly damaging 0.70
R2698:Pabpc1l UTSW 2 164044382 critical splice donor site probably null
R3925:Pabpc1l UTSW 2 164027676 splice site probably benign
R3944:Pabpc1l UTSW 2 164042327 missense probably damaging 1.00
R4052:Pabpc1l UTSW 2 164043613 missense probably benign 0.20
R4793:Pabpc1l UTSW 2 164027622 missense possibly damaging 0.94
R5001:Pabpc1l UTSW 2 164042518 missense probably benign 0.00
R5104:Pabpc1l UTSW 2 164043587 missense probably benign 0.00
R5456:Pabpc1l UTSW 2 164027660 missense probably damaging 1.00
R5569:Pabpc1l UTSW 2 164043554 missense probably benign 0.00
R5853:Pabpc1l UTSW 2 164049518 missense probably benign 0.00
R5857:Pabpc1l UTSW 2 164044255 splice site probably null
R7107:Pabpc1l UTSW 2 164042479 missense probably damaging 0.99
T0722:Pabpc1l UTSW 2 164042420 missense possibly damaging 0.89
Z1088:Pabpc1l UTSW 2 164032324 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCTCTCCTATACTTGGTGGGCAAAG -3'
(R):5'- AACCCAAAGTCTCTGGAAGCTAACG -3'

Sequencing Primer
(F):5'- ATGGTCCCCCTGTGTGAAAG -3'
(R):5'- TGTACAGGGTTAAGAACCTGG -3'
Posted On2014-04-13