Incidental Mutation 'R1548:Cib1'
ID172329
Institutional Source Beutler Lab
Gene Symbol Cib1
Ensembl Gene ENSMUSG00000030538
Gene Namecalcium and integrin binding 1 (calmyrin)
SynonymsKip
MMRRC Submission 039587-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1548 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80227147-80232813 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 80228414 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 105 (Y105*)
Ref Sequence ENSEMBL: ENSMUSP00000145961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032754] [ENSMUST00000062915] [ENSMUST00000065163] [ENSMUST00000071457] [ENSMUST00000123279] [ENSMUST00000205822] [ENSMUST00000205996] [ENSMUST00000206084] [ENSMUST00000206802]
Predicted Effect probably benign
Transcript: ENSMUST00000032754
SMART Domains Protein: ENSMUSP00000032754
Gene: ENSMUSG00000030539

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Sema 57 494 8.07e-177 SMART
PSI 512 582 4.7e-9 SMART
low complexity region 626 639 N/A INTRINSIC
transmembrane domain 701 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062915
SMART Domains Protein: ENSMUSP00000061808
Gene: ENSMUSG00000050973

DomainStartEndE-ValueType
SCOP:d1kpf__ 150 223 1e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065163
AA Change: Y110*
SMART Domains Protein: ENSMUSP00000070901
Gene: ENSMUSG00000030538
AA Change: Y110*

DomainStartEndE-ValueType
low complexity region 84 100 N/A INTRINSIC
EFh 107 135 4.4e0 SMART
EFh 152 180 1.17e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000071457
AA Change: Y62*
SMART Domains Protein: ENSMUSP00000071401
Gene: ENSMUSG00000030538
AA Change: Y62*

DomainStartEndE-ValueType
low complexity region 36 52 N/A INTRINSIC
EFh 59 87 4.4e0 SMART
EFh 104 132 1.17e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000123279
AA Change: Y36*
SMART Domains Protein: ENSMUSP00000118926
Gene: ENSMUSG00000030538
AA Change: Y36*

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
EFh 33 61 4.4e0 SMART
EFh 78 106 1.17e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144295
Predicted Effect probably benign
Transcript: ENSMUST00000205822
Predicted Effect probably null
Transcript: ENSMUST00000205996
AA Change: Y36*
Predicted Effect probably null
Transcript: ENSMUST00000206084
AA Change: Y105*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206618
Predicted Effect probably benign
Transcript: ENSMUST00000206802
Meta Mutation Damage Score 0.712 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EF-hand domain-containing calcium-binding superfamily. The encoded protein interacts with many other proteins, including the platelet integrin alpha-IIb-beta-3, DNA-dependent protein kinase, presenilin-2, focal adhesion kinase, p21 activated kinase, and protein kinase D. The encoded protein may be involved in cell survival and proliferation, and is associated with several disease states including cancer and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mutation of this gene results in male infertility due to disruption of the haploid phase of spermatogenesis and is associated with small testis size and loss of elongated spermatids and sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik T C 9: 41,581,376 L116P probably damaging Het
A830018L16Rik A T 1: 11,518,594 R78S probably damaging Het
Acad10 G T 5: 121,626,040 probably benign Het
Acad10 G C 5: 121,626,041 probably benign Het
Ang2 C A 14: 51,195,533 E131* probably null Het
Ankfn1 T C 11: 89,526,541 N82D probably damaging Het
Anks1b T C 10: 90,049,985 I181T possibly damaging Het
Bcl2l12 C G 7: 44,992,818 G215R probably damaging Het
Bnc2 A G 4: 84,275,957 Y1044H probably damaging Het
Cacna1s T C 1: 136,110,937 F1172S probably damaging Het
Cct8 A G 16: 87,485,584 I482T probably damaging Het
Cfap74 C T 4: 155,434,045 T580I probably benign Het
Cpa1 G A 6: 30,642,335 G245D probably damaging Het
Csmd3 A G 15: 47,981,975 V801A possibly damaging Het
Ddx10 T C 9: 53,149,561 probably null Het
Ddx4 T C 13: 112,599,997 N613S probably damaging Het
Drd3 A G 16: 43,821,341 D340G probably benign Het
E2f4 A G 8: 105,304,688 *411W probably null Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Foxp1 A T 6: 98,945,420 I450N probably damaging Het
Gm10229 G A 16: 89,015,389 probably benign Het
Gm5771 G T 6: 41,396,011 L72F probably damaging Het
Gm813 A T 16: 58,615,839 D40E probably benign Het
Gpr19 A G 6: 134,870,084 F175S possibly damaging Het
Gpr21 C T 2: 37,518,072 T210M probably damaging Het
Grhl2 C T 15: 37,336,323 A488V probably benign Het
Hif3a T C 7: 17,044,403 T435A probably benign Het
Hoxb4 C T 11: 96,318,899 R44* probably null Het
Ifi47 A G 11: 49,095,871 D155G probably damaging Het
Igdcc4 T C 9: 65,135,227 L142P probably benign Het
Ints6 G A 14: 62,713,692 P296L probably damaging Het
Itga3 A G 11: 95,046,919 probably null Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lgals12 A T 19: 7,604,312 H50Q probably benign Het
Lrp12 A G 15: 39,872,506 S696P probably damaging Het
Lrp6 G A 6: 134,459,429 T1258I possibly damaging Het
Meis2 C T 2: 116,058,702 D190N probably damaging Het
Mon2 C T 10: 123,036,007 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Muc6 A G 7: 141,652,103 probably benign Het
Myo15 A G 11: 60,488,238 H1394R probably damaging Het
Myo5a A T 9: 75,171,746 I929F probably damaging Het
Nek6 T A 2: 38,568,895 Y141N probably damaging Het
Notch4 T A 17: 34,568,422 C319S probably damaging Het
Nwd2 A T 5: 63,800,182 D285V probably benign Het
Olfml1 T C 7: 107,590,375 S216P possibly damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pfkfb2 G T 1: 130,698,083 H453Q probably benign Het
Pigt C T 2: 164,501,519 T305I probably benign Het
Plxnb1 C T 9: 109,100,900 L275F possibly damaging Het
Ppm1d C T 11: 85,339,605 R350C probably damaging Het
Rassf1 C A 9: 107,551,846 P84T probably benign Het
Rgl3 G T 9: 21,980,706 R361S probably benign Het
Rnf213 G A 11: 119,442,707 R2914H probably damaging Het
Ryr2 A T 13: 11,554,549 C4956* probably null Het
Scaper C T 9: 55,816,670 R668H probably damaging Het
Spata6 T C 4: 111,779,006 F165L probably benign Het
Tcirg1 A T 19: 3,896,845 W694R probably benign Het
Tmem245 A T 4: 56,906,233 Y160* probably null Het
Tshr T C 12: 91,534,031 Y279H probably damaging Het
Ttf1 A C 2: 29,065,138 K171N probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Xdh A G 17: 73,913,901 V611A probably damaging Het
Zfp142 G T 1: 74,570,104 H1408N probably damaging Het
Other mutations in Cib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0042:Cib1 UTSW 7 80230378 missense probably benign 0.00
R1132:Cib1 UTSW 7 80228030 missense probably damaging 1.00
R1964:Cib1 UTSW 7 80232372 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTTCATCTCAGAAGCACTGAGCCG -3'
(R):5'- GAGTTTGTAACCCAGGTCATGCCC -3'

Sequencing Primer
(F):5'- CGTGAGGCAATTCACAAGCTG -3'
(R):5'- CAGGTCATGCCCTGTGATG -3'
Posted On2014-04-13