Incidental Mutation 'R1548:Anks1b'
ID172341
Institutional Source Beutler Lab
Gene Symbol Anks1b
Ensembl Gene ENSMUSG00000058589
Gene Nameankyrin repeat and sterile alpha motif domain containing 1B
SynonymsC030032C09Rik, AIDA-1b, LOC380650, Gm10937, E530015N03Rik
MMRRC Submission 039587-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R1548 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location89873509-90973300 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90049985 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 181 (I181T)
Ref Sequence ENSEMBL: ENSMUSP00000138209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099368] [ENSMUST00000182907] [ENSMUST00000182936] [ENSMUST00000183156]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099368
AA Change: I181T

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096968
Gene: ENSMUSG00000058589
AA Change: I181T

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 931 4.44e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182907
SMART Domains Protein: ENSMUSP00000138614
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182936
AA Change: I181T

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138209
Gene: ENSMUSG00000058589
AA Change: I181T

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 5.03e2 SMART
low complexity region 464 479 N/A INTRINSIC
low complexity region 517 543 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183012
Predicted Effect possibly damaging
Transcript: ENSMUST00000183156
AA Change: I181T

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138539
Gene: ENSMUSG00000058589
AA Change: I181T

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 948 5.66e-17 SMART
low complexity region 968 983 N/A INTRINSIC
PTB 1056 1194 2.94e-38 SMART
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons alters hippocampal synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik T C 9: 41,581,376 L116P probably damaging Het
A830018L16Rik A T 1: 11,518,594 R78S probably damaging Het
Acad10 G T 5: 121,626,040 probably benign Het
Acad10 G C 5: 121,626,041 probably benign Het
Ang2 C A 14: 51,195,533 E131* probably null Het
Ankfn1 T C 11: 89,526,541 N82D probably damaging Het
Bcl2l12 C G 7: 44,992,818 G215R probably damaging Het
Bnc2 A G 4: 84,275,957 Y1044H probably damaging Het
Cacna1s T C 1: 136,110,937 F1172S probably damaging Het
Cct8 A G 16: 87,485,584 I482T probably damaging Het
Cfap74 C T 4: 155,434,045 T580I probably benign Het
Cib1 A T 7: 80,228,414 Y105* probably null Het
Cpa1 G A 6: 30,642,335 G245D probably damaging Het
Csmd3 A G 15: 47,981,975 V801A possibly damaging Het
Ddx10 T C 9: 53,149,561 probably null Het
Ddx4 T C 13: 112,599,997 N613S probably damaging Het
Drd3 A G 16: 43,821,341 D340G probably benign Het
E2f4 A G 8: 105,304,688 *411W probably null Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Foxp1 A T 6: 98,945,420 I450N probably damaging Het
Gm10229 G A 16: 89,015,389 probably benign Het
Gm5771 G T 6: 41,396,011 L72F probably damaging Het
Gm813 A T 16: 58,615,839 D40E probably benign Het
Gpr19 A G 6: 134,870,084 F175S possibly damaging Het
Gpr21 C T 2: 37,518,072 T210M probably damaging Het
Grhl2 C T 15: 37,336,323 A488V probably benign Het
Hif3a T C 7: 17,044,403 T435A probably benign Het
Hoxb4 C T 11: 96,318,899 R44* probably null Het
Ifi47 A G 11: 49,095,871 D155G probably damaging Het
Igdcc4 T C 9: 65,135,227 L142P probably benign Het
Ints6 G A 14: 62,713,692 P296L probably damaging Het
Itga3 A G 11: 95,046,919 probably null Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lgals12 A T 19: 7,604,312 H50Q probably benign Het
Lrp12 A G 15: 39,872,506 S696P probably damaging Het
Lrp6 G A 6: 134,459,429 T1258I possibly damaging Het
Meis2 C T 2: 116,058,702 D190N probably damaging Het
Mon2 C T 10: 123,036,007 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Muc6 A G 7: 141,652,103 probably benign Het
Myo15 A G 11: 60,488,238 H1394R probably damaging Het
Myo5a A T 9: 75,171,746 I929F probably damaging Het
Nek6 T A 2: 38,568,895 Y141N probably damaging Het
Notch4 T A 17: 34,568,422 C319S probably damaging Het
Nwd2 A T 5: 63,800,182 D285V probably benign Het
Olfml1 T C 7: 107,590,375 S216P possibly damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pfkfb2 G T 1: 130,698,083 H453Q probably benign Het
Pigt C T 2: 164,501,519 T305I probably benign Het
Plxnb1 C T 9: 109,100,900 L275F possibly damaging Het
Ppm1d C T 11: 85,339,605 R350C probably damaging Het
Rassf1 C A 9: 107,551,846 P84T probably benign Het
Rgl3 G T 9: 21,980,706 R361S probably benign Het
Rnf213 G A 11: 119,442,707 R2914H probably damaging Het
Ryr2 A T 13: 11,554,549 C4956* probably null Het
Scaper C T 9: 55,816,670 R668H probably damaging Het
Spata6 T C 4: 111,779,006 F165L probably benign Het
Tcirg1 A T 19: 3,896,845 W694R probably benign Het
Tmem245 A T 4: 56,906,233 Y160* probably null Het
Tshr T C 12: 91,534,031 Y279H probably damaging Het
Ttf1 A C 2: 29,065,138 K171N probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Xdh A G 17: 73,913,901 V611A probably damaging Het
Zfp142 G T 1: 74,570,104 H1408N probably damaging Het
Other mutations in Anks1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Anks1b APN 10 90897238 splice site probably benign
IGL01890:Anks1b APN 10 90644527 missense probably benign 0.15
IGL01966:Anks1b APN 10 90895132 missense probably damaging 1.00
IGL02176:Anks1b APN 10 90042668 missense probably damaging 0.99
IGL02205:Anks1b APN 10 90071094 missense probably benign 0.00
IGL02465:Anks1b APN 10 90163265 nonsense probably null
IGL02534:Anks1b APN 10 90895117 missense probably benign 0.45
IGL02554:Anks1b APN 10 90921378 missense probably damaging 1.00
IGL02820:Anks1b APN 10 90077059 missense possibly damaging 0.93
IGL03164:Anks1b APN 10 90042692 missense probably damaging 1.00
R0096:Anks1b UTSW 10 90074062 missense possibly damaging 0.90
R0482:Anks1b UTSW 10 90359195 missense probably benign 0.00
R0542:Anks1b UTSW 10 90073967 splice site probably benign
R0848:Anks1b UTSW 10 90071125 missense probably damaging 0.99
R1056:Anks1b UTSW 10 90921429 splice site probably null
R1398:Anks1b UTSW 10 90050029 missense probably damaging 1.00
R1446:Anks1b UTSW 10 90511073 missense probably benign 0.00
R1551:Anks1b UTSW 10 90076981 missense probably benign 0.00
R1607:Anks1b UTSW 10 90042548 missense probably damaging 1.00
R1667:Anks1b UTSW 10 90511184 critical splice donor site probably null
R1701:Anks1b UTSW 10 90049954 missense probably damaging 1.00
R1843:Anks1b UTSW 10 90512889 critical splice donor site probably null
R1899:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R1957:Anks1b UTSW 10 90049930 missense probably damaging 1.00
R2036:Anks1b UTSW 10 90969853 missense probably damaging 0.99
R2279:Anks1b UTSW 10 90050096 missense probably damaging 1.00
R2280:Anks1b UTSW 10 90966302 missense probably damaging 1.00
R2937:Anks1b UTSW 10 90077066 missense probably damaging 1.00
R3739:Anks1b UTSW 10 90033216 missense probably damaging 1.00
R4061:Anks1b UTSW 10 90307622 missense probably damaging 0.98
R4459:Anks1b UTSW 10 90510844 missense probably damaging 1.00
R4479:Anks1b UTSW 10 90049892 missense probably damaging 1.00
R4510:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4511:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4780:Anks1b UTSW 10 89873732 missense probably damaging 1.00
R4785:Anks1b UTSW 10 90914750 missense probably null 0.88
R4790:Anks1b UTSW 10 90163275 missense probably damaging 0.99
R5012:Anks1b UTSW 10 90359137 missense probably benign 0.06
R5400:Anks1b UTSW 10 90512824 missense probably damaging 1.00
R5586:Anks1b UTSW 10 90077064 missense probably damaging 0.98
R5687:Anks1b UTSW 10 90914711 missense probably benign 0.03
R5899:Anks1b UTSW 10 90923517 splice site probably null
R5917:Anks1b UTSW 10 90576941 intron probably benign
R5999:Anks1b UTSW 10 90359048 missense probably damaging 1.00
R6080:Anks1b UTSW 10 90966349 nonsense probably null
R6216:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R6265:Anks1b UTSW 10 90941500 missense probably damaging 1.00
R6298:Anks1b UTSW 10 90680837 missense probably damaging 1.00
R6337:Anks1b UTSW 10 90921296 missense probably benign 0.27
R6522:Anks1b UTSW 10 90897327 intron probably benign
R6843:Anks1b UTSW 10 90948598 missense probably damaging 1.00
R6852:Anks1b UTSW 10 90260654 missense probably damaging 1.00
R6933:Anks1b UTSW 10 90069490 missense probably damaging 1.00
R7114:Anks1b UTSW 10 90307698 missense probably damaging 1.00
X0064:Anks1b UTSW 10 90512845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTGTGTGGCTAAGCCATTACTC -3'
(R):5'- GCACAGCTTCCAGACTCACTTGAC -3'

Sequencing Primer
(F):5'- GGCTAAGCCATTACTCTTGGAAG -3'
(R):5'- GACTCACTTGACAGCTCACG -3'
Posted On2014-04-13