Incidental Mutation 'R1548:Itga3'
ID172347
Institutional Source Beutler Lab
Gene Symbol Itga3
Ensembl Gene ENSMUSG00000001507
Gene Nameintegrin alpha 3
SynonymsVLA-3 alpha 3, alpha3-integrin
MMRRC Submission 039587-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1548 (G1)
Quality Score220
Status Validated
Chromosome11
Chromosomal Location95044474-95076801 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 95046919 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001548] [ENSMUST00000107739] [ENSMUST00000120375]
Predicted Effect probably null
Transcript: ENSMUST00000001548
SMART Domains Protein: ENSMUSP00000001548
Gene: ENSMUSG00000001507

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Int_alpha 48 110 4.18e-7 SMART
Int_alpha 246 300 5.01e0 SMART
Int_alpha 304 361 3.07e-14 SMART
Int_alpha 366 419 4.17e-16 SMART
Int_alpha 427 483 7.57e1 SMART
low complexity region 521 534 N/A INTRINSIC
SCOP:d1m1xa3 758 984 7e-54 SMART
transmembrane domain 994 1016 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107739
SMART Domains Protein: ENSMUSP00000103368
Gene: ENSMUSG00000001507

DomainStartEndE-ValueType
Int_alpha 20 79 1.05e2 SMART
Int_alpha 215 269 5.01e0 SMART
Int_alpha 273 330 3.07e-14 SMART
Int_alpha 335 388 4.17e-16 SMART
Int_alpha 396 452 7.57e1 SMART
low complexity region 490 503 N/A INTRINSIC
low complexity region 775 789 N/A INTRINSIC
transmembrane domain 963 985 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120375
SMART Domains Protein: ENSMUSP00000113556
Gene: ENSMUSG00000001507

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Int_alpha 48 110 4.18e-7 SMART
Int_alpha 246 300 5.01e0 SMART
Int_alpha 304 361 3.07e-14 SMART
Int_alpha 366 419 4.17e-16 SMART
Int_alpha 427 483 7.57e1 SMART
low complexity region 521 534 N/A INTRINSIC
SCOP:d1m1xa3 758 984 2e-53 SMART
transmembrane domain 994 1016 N/A INTRINSIC
Meta Mutation Damage Score 0.564 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: This gene encodes a subunit of integrin family of cell surface proteins. The encoded protein undergoes post-translational processing to form a disulfide bond-linked dimer comprised of heavy and light chains. At the cell surface, the encoded protein non-covalently associates with the integrin beta-1 subunit to form a heterodimer that interacts with many extracellular matrix proteins including fibronectin and laminin. Mice lacking the encoded protein die during the first day after birth due to severe abnormalities in kidneys. Mice lacking the encoded protein specifically in the basal layer of epidermis display several skin defects and accelerated wound healing. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the kidney and submandibular gland, decreased bronchial branching of the lungs, skin blisters at the dermal-epidermal junction, abnormal layering of the cerebral cortex and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik T C 9: 41,581,376 L116P probably damaging Het
A830018L16Rik A T 1: 11,518,594 R78S probably damaging Het
Acad10 G T 5: 121,626,040 probably benign Het
Acad10 G C 5: 121,626,041 probably benign Het
Ang2 C A 14: 51,195,533 E131* probably null Het
Ankfn1 T C 11: 89,526,541 N82D probably damaging Het
Anks1b T C 10: 90,049,985 I181T possibly damaging Het
Bcl2l12 C G 7: 44,992,818 G215R probably damaging Het
Bnc2 A G 4: 84,275,957 Y1044H probably damaging Het
Cacna1s T C 1: 136,110,937 F1172S probably damaging Het
Cct8 A G 16: 87,485,584 I482T probably damaging Het
Cfap74 C T 4: 155,434,045 T580I probably benign Het
Cib1 A T 7: 80,228,414 Y105* probably null Het
Cpa1 G A 6: 30,642,335 G245D probably damaging Het
Csmd3 A G 15: 47,981,975 V801A possibly damaging Het
Ddx10 T C 9: 53,149,561 probably null Het
Ddx4 T C 13: 112,599,997 N613S probably damaging Het
Drd3 A G 16: 43,821,341 D340G probably benign Het
E2f4 A G 8: 105,304,688 *411W probably null Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Foxp1 A T 6: 98,945,420 I450N probably damaging Het
Gm10229 G A 16: 89,015,389 probably benign Het
Gm5771 G T 6: 41,396,011 L72F probably damaging Het
Gm813 A T 16: 58,615,839 D40E probably benign Het
Gpr19 A G 6: 134,870,084 F175S possibly damaging Het
Gpr21 C T 2: 37,518,072 T210M probably damaging Het
Grhl2 C T 15: 37,336,323 A488V probably benign Het
Hif3a T C 7: 17,044,403 T435A probably benign Het
Hoxb4 C T 11: 96,318,899 R44* probably null Het
Ifi47 A G 11: 49,095,871 D155G probably damaging Het
Igdcc4 T C 9: 65,135,227 L142P probably benign Het
Ints6 G A 14: 62,713,692 P296L probably damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lgals12 A T 19: 7,604,312 H50Q probably benign Het
Lrp12 A G 15: 39,872,506 S696P probably damaging Het
Lrp6 G A 6: 134,459,429 T1258I possibly damaging Het
Meis2 C T 2: 116,058,702 D190N probably damaging Het
Mon2 C T 10: 123,036,007 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Muc6 A G 7: 141,652,103 probably benign Het
Myo15 A G 11: 60,488,238 H1394R probably damaging Het
Myo5a A T 9: 75,171,746 I929F probably damaging Het
Nek6 T A 2: 38,568,895 Y141N probably damaging Het
Notch4 T A 17: 34,568,422 C319S probably damaging Het
Nwd2 A T 5: 63,800,182 D285V probably benign Het
Olfml1 T C 7: 107,590,375 S216P possibly damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pfkfb2 G T 1: 130,698,083 H453Q probably benign Het
Pigt C T 2: 164,501,519 T305I probably benign Het
Plxnb1 C T 9: 109,100,900 L275F possibly damaging Het
Ppm1d C T 11: 85,339,605 R350C probably damaging Het
Rassf1 C A 9: 107,551,846 P84T probably benign Het
Rgl3 G T 9: 21,980,706 R361S probably benign Het
Rnf213 G A 11: 119,442,707 R2914H probably damaging Het
Ryr2 A T 13: 11,554,549 C4956* probably null Het
Scaper C T 9: 55,816,670 R668H probably damaging Het
Spata6 T C 4: 111,779,006 F165L probably benign Het
Tcirg1 A T 19: 3,896,845 W694R probably benign Het
Tmem245 A T 4: 56,906,233 Y160* probably null Het
Tshr T C 12: 91,534,031 Y279H probably damaging Het
Ttf1 A C 2: 29,065,138 K171N probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Xdh A G 17: 73,913,901 V611A probably damaging Het
Zfp142 G T 1: 74,570,104 H1408N probably damaging Het
Other mutations in Itga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Itga3 APN 11 95065886 missense probably damaging 1.00
IGL02020:Itga3 APN 11 95057390 missense probably benign 0.02
IGL02413:Itga3 APN 11 95068771 missense probably damaging 1.00
IGL02562:Itga3 APN 11 95068793 missense probably benign 0.02
PIT4508001:Itga3 UTSW 11 95055893 missense probably benign 0.20
R0485:Itga3 UTSW 11 95061970 missense probably benign 0.05
R1677:Itga3 UTSW 11 95055759 missense probably damaging 0.96
R2062:Itga3 UTSW 11 95054076 missense possibly damaging 0.92
R2088:Itga3 UTSW 11 95052494 missense probably benign 0.10
R2679:Itga3 UTSW 11 95068310 splice site probably benign
R3697:Itga3 UTSW 11 95062725 missense probably benign 0.00
R3839:Itga3 UTSW 11 95057269 critical splice donor site probably null
R4210:Itga3 UTSW 11 95062623 missense probably benign 0.00
R4533:Itga3 UTSW 11 95057293 missense probably benign 0.15
R4849:Itga3 UTSW 11 95076271 missense probably benign
R4863:Itga3 UTSW 11 95061967 missense probably damaging 1.00
R4889:Itga3 UTSW 11 95068301 missense probably benign 0.13
R5218:Itga3 UTSW 11 95062748 missense probably benign 0.01
R6046:Itga3 UTSW 11 95062715 missense probably benign 0.28
R6087:Itga3 UTSW 11 95052443 critical splice donor site probably null
R6210:Itga3 UTSW 11 95068891 intron probably benign
R6341:Itga3 UTSW 11 95055851 splice site probably null
R6666:Itga3 UTSW 11 95065826 missense probably benign 0.00
R6998:Itga3 UTSW 11 95051462 missense probably benign 0.00
R7106:Itga3 UTSW 11 95055873 missense probably benign 0.00
R7164:Itga3 UTSW 11 95052479 missense possibly damaging 0.85
R7267:Itga3 UTSW 11 95076362 intron probably benign
R7421:Itga3 UTSW 11 95068855 missense probably benign 0.20
R7514:Itga3 UTSW 11 95065896 nonsense probably null
R7533:Itga3 UTSW 11 95046518 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- ACCTGGAAAGCTAAGTCCTGAGCC -3'
(R):5'- TCTAAGACCTGCTGGTGTCCATGAG -3'

Sequencing Primer
(F):5'- GCTTCCTGGATAGCCAGATAC -3'
(R):5'- CCCTAGTGGCTGTAGGTCAAATG -3'
Posted On2014-04-13