Incidental Mutation 'R0256:Sval3'
ID172395
Institutional Source Beutler Lab
Gene Symbol Sval3
Ensembl Gene ENSMUSG00000062833
Gene Nameseminal vesicle antigen-like 3
Synonyms
MMRRC Submission 038487-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R0256 (G1)
Quality Score48
Status Validated
Chromosome6
Chromosomal Location41968140-41973090 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41972905 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 122 (D122G)
Ref Sequence ENSEMBL: ENSMUSP00000079566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080742]
Predicted Effect probably damaging
Transcript: ENSMUST00000080742
AA Change: D122G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079566
Gene: ENSMUSG00000062833
AA Change: D122G

DomainStartEndE-ValueType
Pfam:SVA 3 123 4.7e-46 PFAM
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.6%
  • 10x: 95.8%
  • 20x: 92.8%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 36,917,773 V552L probably benign Het
9330159F19Rik G T 10: 29,222,256 L186F probably damaging Het
Abce1 A C 8: 79,685,943 probably null Het
Acvrl1 A T 15: 101,137,121 N254Y probably damaging Het
Apip T A 2: 103,088,571 M72K possibly damaging Het
Arg1 A G 10: 24,916,458 Y188H probably benign Het
Armc3 A T 2: 19,269,216 N354Y probably damaging Het
Arrdc5 A G 17: 56,294,382 F248L probably damaging Het
Atp8b5 T C 4: 43,302,576 probably benign Het
Ccdc154 C T 17: 25,170,632 A490V probably benign Het
Cdh6 T C 15: 13,053,782 probably benign Het
Chmp2b G T 16: 65,540,192 T193K probably benign Het
Clca3a1 A T 3: 144,730,879 N814K probably damaging Het
Cmtr1 T C 17: 29,697,124 L576P probably damaging Het
Fhl5 T C 4: 25,213,624 H104R probably benign Het
Foxk1 A G 5: 142,453,681 probably benign Het
Gm11596 T A 11: 99,792,716 T193S unknown Het
Gm15217 A T 14: 46,380,396 probably benign Het
Hic2 A G 16: 17,257,513 I69V probably benign Het
Ivl T C 3: 92,571,843 D305G probably damaging Het
Kcnn2 A G 18: 45,592,405 T323A probably damaging Het
Krt7 C T 15: 101,423,309 Q336* probably null Het
Krt73 T G 15: 101,801,936 D121A probably damaging Het
Mok T C 12: 110,808,105 D216G probably damaging Het
Muc3 A G 5: 137,146,691 C44R probably damaging Het
Muc5b T C 7: 141,843,258 F223L unknown Het
Muc5b A G 7: 141,841,395 Y46C unknown Het
Noct A G 3: 51,250,474 D411G probably damaging Het
Olfr1106 T C 2: 87,049,056 Y60C probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr813 A T 10: 129,857,037 D173V probably damaging Het
Pigv T C 4: 133,665,751 H36R probably damaging Het
Plscr3 A G 11: 69,850,054 K239E probably damaging Het
Prkag3 T C 1: 74,741,171 D445G probably benign Het
Ramp1 A T 1: 91,196,919 probably benign Het
Ror1 T A 4: 100,409,745 H214Q probably benign Het
Selenbp2 A T 3: 94,699,701 H156L probably benign Het
Slc28a3 T C 13: 58,573,500 T284A probably benign Het
Slc35a1 T C 4: 34,668,962 T284A probably benign Het
Smco2 A T 6: 146,861,746 I184F probably damaging Het
Son A G 16: 91,656,584 M740V possibly damaging Het
Stil T A 4: 115,023,685 N475K possibly damaging Het
Tnks A G 8: 34,861,547 M623T probably benign Het
Zfp142 A G 1: 74,578,158 V235A probably benign Het
Zfp423 A T 8: 87,773,634 C1053* probably null Het
Zfp648 T A 1: 154,205,668 D524E probably benign Het
Other mutations in Sval3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Sval3 APN 6 41972521 missense probably benign
IGL02004:Sval3 APN 6 41972842 splice site probably benign
IGL02366:Sval3 APN 6 41969725 splice site probably benign
R0310:Sval3 UTSW 6 41968186 missense probably damaging 1.00
R1796:Sval3 UTSW 6 41968162 missense probably benign 0.03
R6541:Sval3 UTSW 6 41972446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCATTTCCCACCCGCTTATG -3'
(R):5'- TGAAACCTGGTCCTGACCTCACTC -3'

Sequencing Primer
(F):5'- TTCTGGAGTACTGATGAGAAACC -3'
(R):5'- GCTGGGCAGATACAGTAGTAATTTC -3'
Posted On2014-04-23