Incidental Mutation 'R1227:Ddx31'
ID172401
Institutional Source Beutler Lab
Gene Symbol Ddx31
Ensembl Gene ENSMUSG00000026806
Gene NameDEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
Synonyms
MMRRC Submission 039296-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R1227 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location28840406-28905571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28857175 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 222 (E222G)
Ref Sequence ENSEMBL: ENSMUSP00000109484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113853]
Predicted Effect probably damaging
Transcript: ENSMUST00000113853
AA Change: E222G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109484
Gene: ENSMUSG00000026806
AA Change: E222G

DomainStartEndE-ValueType
DEXDc 123 332 2.28e-48 SMART
HELICc 408 487 4.02e-26 SMART
DUF4217 556 621 6.21e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152685
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd42 T A 7: 92,605,300 H367L possibly damaging Het
Arvcf C T 16: 18,389,304 R43C probably benign Het
Camk1g T C 1: 193,347,433 E453G possibly damaging Het
Cmya5 A T 13: 93,094,446 L1378Q probably damaging Het
Cplx1 T C 5: 108,525,396 D53G possibly damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fermt2 A G 14: 45,459,990 S635P probably benign Het
Gls2 T C 10: 128,199,664 S104P probably damaging Het
Gm13023 A G 4: 143,793,564 H126R probably benign Het
Hnrnpul2 T G 19: 8,823,237 S226A possibly damaging Het
Klk5 T C 7: 43,847,246 probably null Het
Nuak1 T A 10: 84,440,309 T17S probably benign Het
Olfr1453 T C 19: 13,027,853 M159V probably benign Het
Olfr474 C A 7: 107,955,052 S137Y probably damaging Het
Prag1 G A 8: 36,139,951 E949K probably damaging Het
Rasal1 T C 5: 120,670,307 L468P probably damaging Het
Sez6l C A 5: 112,473,464 C248F probably damaging Het
Sstr2 T C 11: 113,624,885 I210T probably damaging Het
Tbc1d2 C T 4: 46,620,629 G394S probably benign Het
Zfp108 T A 7: 24,260,460 W159R probably benign Het
Other mutations in Ddx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Ddx31 APN 2 28875835 splice site probably benign
IGL01918:Ddx31 APN 2 28874164 missense probably damaging 1.00
IGL02174:Ddx31 APN 2 28859029 missense probably damaging 1.00
IGL02560:Ddx31 APN 2 28875826 missense probably damaging 1.00
IGL02938:Ddx31 APN 2 28859023 missense possibly damaging 0.49
R0241:Ddx31 UTSW 2 28848291 missense probably damaging 1.00
R0241:Ddx31 UTSW 2 28848291 missense probably damaging 1.00
R0440:Ddx31 UTSW 2 28857132 missense probably damaging 1.00
R0701:Ddx31 UTSW 2 28858777 missense probably null 1.00
R0729:Ddx31 UTSW 2 28874174 missense probably damaging 1.00
R1532:Ddx31 UTSW 2 28881159 missense probably benign 0.00
R1608:Ddx31 UTSW 2 28859066 missense probably damaging 0.97
R1646:Ddx31 UTSW 2 28892520 missense probably benign
R1674:Ddx31 UTSW 2 28858816 missense probably damaging 1.00
R1834:Ddx31 UTSW 2 28892453 missense probably damaging 1.00
R1884:Ddx31 UTSW 2 28858990 missense probably damaging 0.97
R4133:Ddx31 UTSW 2 28858852 missense probably damaging 1.00
R4911:Ddx31 UTSW 2 28904684 missense probably benign 0.00
R4972:Ddx31 UTSW 2 28860770 missense probably damaging 1.00
R5240:Ddx31 UTSW 2 28846030 missense probably benign 0.03
R5358:Ddx31 UTSW 2 28863770 missense probably damaging 0.98
R5450:Ddx31 UTSW 2 28886969 missense probably damaging 0.97
R5945:Ddx31 UTSW 2 28859890 missense probably damaging 1.00
R5956:Ddx31 UTSW 2 28874173 missense probably damaging 1.00
R6235:Ddx31 UTSW 2 28844842 missense probably benign 0.00
R6245:Ddx31 UTSW 2 28844982 missense probably benign 0.00
R6463:Ddx31 UTSW 2 28847513 critical splice donor site probably null
R6647:Ddx31 UTSW 2 28875738 missense probably damaging 1.00
R6783:Ddx31 UTSW 2 28874176 missense probably benign 0.26
R6917:Ddx31 UTSW 2 28892409 missense probably damaging 1.00
R7135:Ddx31 UTSW 2 28848306 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGGAGACACTTAGTGTTCCCTGC -3'
(R):5'- CCACTGAAGTGCCATTTACCTACCC -3'

Sequencing Primer
(F):5'- TTCCCTGCTGTAGATTGGC -3'
(R):5'- tttgaatacagtgtcttatgtagtcc -3'
Posted On2014-04-24